d2EGFP Primers for Genotyping - ...where to get the sequence? (Dec/02/2010 )

Hi everybody,

I recently got mice expressing d2EGFP under control of various promoters. In order to genotype them, I was trying to get the sequence of d2EGFP or literature in which people have already used d2EGFP primers for genotyping. I found one paper (Man et al , 2007) that have done it and also provide primer sequences. However, these do not seem to work in my mice.

Thank you very much for your help!

All the best,

Tobias

Hi Tobias,

From what you describe, it seems to me that maybe your primers are not specific to the d2EGFP insert you are using. If you post the sequences of the primers, and the d2EGFP insert/gene, maybe we can help you out in determining what is the problem here. In my experience EGFP primers that were designed for one EGFP do not necessarily work for another EGFP, in part because there are many EGFP versions and each has numerous mutations (which may not be compatible with various EGFP primer sets).

Cheers,

Ivan

Dear Ivan,

thank you very much for your reply.
The main problem for me is that I dont have the sequence of the d2EGFP used on the mice. The primers that I used are below:


Forward: 5-cggcatcaaggtgaacttcaagatccg-3;

Reverse: 5-cttgtacagctcgtccatgccg-3

However using the primer sequence I was not able to get info on the sequence or the product they should amplify.
I am really stuck here...

Again, thank you very much for your help!

Tobias

d2EGFP has the sequence
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGAAGCTTAGCCATGGCTTCCCGCCGGAGGTGGAGGAGCAGGATGATGGCACGCTGCCCATGTCTTGTGCCCAGGAGAGCGGGATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGGATCAATGTGTAG
you can find the sequence at Clontech http://www.clontech.com/support/dis_vectors.asp?alpha=d
when you use the mentioned primers, you will get a PCR product of 238bp. They are however not specific for the MODC form of eGFP.

rsm

Dear RSM,

Thank you very much for your reply. Using the sequence you provided, I was able to design new primers that work!
Problem solved, thank you very much!
Tobias

Rsm on Fri Dec 3 07:43:06 2010 said:

You're welcome