Primer design help needed - (Oct/20/2010 )
Ok, so I want to order an oligo with a T7 promoter sequence in it and make it double stranded, so that later I can do in vitro transcritption on it with T7 polymerase. I am new at doing this, and completely lost.
If this is my sequence of the big oligo that I want to make double stranded (in bold is the T7 promoter sequence): 5' TAATACGACTCACTATAGGGAGTCGACCGACCAGAATATGTGTCATCAGAGACTCAT3'
how do I design a primer that will anneal to it and make it double stranded, if I want to use it later for IVT? I don't really care about the sequence, as long as I have T7 in it.
From what I picked up, I should write the big oligo from 3' to 5' (is it then 3' TAC... or is it 3' TAA..), and then anneal a primer that's complementary to the T7 sequence at the 3' end of the big oligo, because the polymerase reads 5' to 3'. Does that make any sense?
Thank you in advance,
Khia
Khia on Wed Oct 20 14:19:16 2010 said:
Ok, so I want to order an oligo with a T7 promoter sequence in it and make it double stranded, so that later I can do in vitro transcritption on it with T7 polymerase. I am new at doing this, and completely lost.
If this is my sequence of the big oligo that I want to make double stranded (in bold is the T7 promoter sequence): 5' TAATACGACTCACTATAGGGAGTCGACCGACCAGAATATGTGTCATCAGAGACTCAT3'
how do I design a primer that will anneal to it and make it double stranded, if I want to use it later for IVT? I don't really care about the sequence, as long as I have T7 in it.
From what I picked up, I should write the big oligo from 3' to 5' (is it then 3' TAC... or is it 3' TAA..), and then anneal a primer that's complementary to the T7 sequence at the 3' end of the big oligo, because the polymerase reads 5' to 3'. Does that make any sense?
Thank you in advance,
Khia
There appears to be a little confusion on what you are wanting to do so lets back up and make sure we understand what your goal is. I am assuming you are wanting to do an in vitro transcription reaction with a specific gene, correct? In order to get an in vitro transcription reaction, you need to put the T7 promoter upstream of your gene of interest. You have many potential methods to do this. One, you order the forward that contains the T7 promoter and a reverse that is specific to the 3' end of your gene. Do a pcr to amplify the entire gene with the upstream T7 and subclone this into your vector of choice. This requires you design a forward and reverse primer with restriction digest sites that are present in your desired vector and not present in your insert. Or, rather than subcloning the T7 promoter into the vector, are you planning on doing the T7 in vitro transcription reaction with the pcr product? Your primers would be the same except that you don't need the restriction sites. But, rather than making a reverse primer complimentary to the forward containing the T7 promoter, it needs to be complimentary to the end of your gene and contains a stop codon. Another choice is to insert the T7 promoter upstream of your gene of interest in a vector already containing the gene. Again, you are going to need to design primers with restriction sites that are present upstream of your gene in the vector and are not present in your gene. This way you order the forward and reverse primers that have the digestion sites and the entire T7 promoter, anneal them, digest and ligate the T7 into the vector. With what you have said, you will get a double strand oligo that contains the T7 promoter but you have no way of including your gene.
By the way, all oligos are synthesized from 5'-3' and a reverse primer must always be reverse, complimentary. For example, if you had a forward primer of 5'-ATCGACTAATCGGCTACGTAG-3', a reverse complimentary primer would be 5'-CTACGTAGCCGATTAGTCGAT-3'. These will anneal and form a double strand. You do the same thing when designing a reverse primer to the gene. Look at the end of the gene's sequence and go backwards into the gene writing the complimentary sequence. Geez, I hope this makes sense. It's really hard to explain over the internet and much easier in person. Perhaps you can get someone in your lab to take a little time to really help you learn how to properly design primers. It will save you much time and heartache down the road!!!
