Primer Design with Primer-Blast - My experience has been worse than just using Primer3 and BLAT separate (Oct/19/2010 )
I'm trying to design primers for the following sequence. The sequence of interest is prefixed and suffixed with 60 nucleotides in which I'd like to place the primers (although they could be further out, if necessary).
TCCTCAAATTACATACGCCTACCTTGTTAATACTTCCGATTCCTTTTC
CTCTTCTCTCAGAACCCATTTTTAGAGGTCAGAGTTACAGACACACCGAAACGGTCCCGC
AGAGATTTTGGCCTTGACTGTGATGAGCACTCAACGGAATCCCGATGTTGTCGCTACCCG
CTGACAGTGGATTTCGAAGCTTTTGGATGGGACTGGATTATAGCACCTAAAAGATACAAA
GCCAATTACTGCTCCGGAGAATGCGAATTTGTGTTTCTACAGAAATACCCGCACACTCAC
CTGGTACACCAAGCAAATCCCAGAGGCTCAGCAGGCCCTTGCTGCACACCCACCAAGATG
TCCCCTATAAACATGCTGTATTTCAATGGAAAAGAACAAATAATATATGGAAAGATACCA
GCCATGGTTGTAGATCGTTGCGGGTGCTCATGAGGCTGTCGTGAGATCCACCATTCGATA
AATTGTGGAAGCCACCAAAAAAAAAAGCTATATCCCCTCATCCATCTTTGAAACTGTGAA
ATTACGTACGCTAGGCATT
First, I put this into Primer3 with '60,427' in the Targets field. This worked out great and I got a couple of primers which I then put into BLAT to ensure they didn't occur elsewhere in the Chicken genome.
Then I discovered Primer-Blast which is uses Primer3 and Blast together, which I figured would make the whole thing a lot easier. I put in my sequence and the limits 1 to 60 for forward and 487 to 547 for reverse primers and specified the organism (Gallus gallus) whose genome ought be checked against.
In return, I received the error:
The Primer-Blast interface doesn't have any option for repeat filtering. Could anyone offer some insight?
In my opinion the problem lies with the Tm . Try lowering the default min value of 57.
ElHo on Tue Oct 19 14:12:48 2010 said:
In my opinion the problem lies with the Tm . Try lowering the default min value of 57.
Thanks for the reply - I can do that, but the default value of 57 is the same for Primer3 and Primer-Blast, so it should function just the same?
Edit: I've also noticed that BLAT shouldn't be used for this purpose; it doesn't report alignments less than 95%!
Primer-Blast also seems to ascribe lower Tms to the primers than does Primer3.
Tm calculations are done differently using default options for both programs (SantaLucia 1998 for Blast and Breslauer et al for Primer3). That`s why calculated Tms are different for identical primers
Primer3 has more options for primer design like targets or excluded region marking with brackets, so I use it to design primers, and THEN I check them in PrimerBLAST.
