Adding Restriction Site to DNA - (Oct/06/2010 )
First off, I am new to both molecular biology and also to this site. I'm actually a business student with only some college biology under my belt. My question is regarding PCR and more specifically taking a piece of DNA and amplifying it, then digesting it using to added restriction sites.
The to enzymes I am interested in added are 5' BamHI
and PvuI 3'
My original DNA sequence is
AAG TCGCTTTATCGTACCCTGAACGGTTACGTACTAACACCTGGCAA
I ran my almost 50 base pair DNA through a cutter and came out with something looking like this:
Base Pairs
so as of now I have complimentary pairs, but I am really confused as to where my restriction sites go... I started doing to searching around and looking for different primers, or even using part of my code as a primer.
Can someone with some experience with DNA amplification point me in the right direction, I've been looking at this for a few hours now and have been making little progress, something tells me I am over complicating this.
If you want to amplify your DNA, you need a pair of forward and reverse primers. To add restriction sites, your primers will be designed to contain your restriction sites, followed by a short stretch of your DNA sequence. For your case using BamHI (cleavage site GGATCC) and PvuI (CGATCG),
Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.
Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.
I think I followed the general idea of what you tried to do, and to answer your question, this isn't a synthized strand I am using, it's simply a tutorial problem. With that said I took a look at what you did and using my original strand from above I now have something that came out looking like this: donny on Thu Oct 7 15:49:16 2010 said:
DNA Strand:
Making the final sequence after digestion with the two added restriction enzymes:
GATCGCCCTAGGTTCAGCGAAATAGCATGGGACTTGCCAATGCATGATTGTGGACCGTTCGATCGTGCATG
Does this look like it would work now, or am I still misunderstanding the setup?
If you want to amplify your DNA, you need a pair of forward and reverse primers. To add restriction sites, your primers will be designed to contain your restriction sites, followed by a short stretch of your DNA sequence. For your case using BamHI (cleavage site GGATCC) and PvuI (CGATCG),
Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.
Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.
You've got the idea and is almost correct. However, there are a few problems.
(1)Your PCR won't work.
(2)The "final sequence after digestion with the two added restriction enzymes" you showed is only the PCR product. It hasn't been digested.
Since this is a tutorial question, I won't spoon feed you 
Hint:
(1) Your reverse primer is missing something.
(2) The digested sequence is shorter.