Fusion PCR, bright smear from well to end(with very weak or no band) - (Sep/05/2010 )

My partner did fusion for 2 fragments(1260bp+719bp) but always get smear from well to end. She changed the concentration from 5-50ng each fragments for a total volume of 25microlitre, and also tried different temperature with a range of 10centigrades.
1.My instructor suggested it may be the problem of big molecule stuck the DNA running on the gel, which might be enzyme. Therefore, my partner tried one more time, use phenol chloroform to remove the protein from PCR product and then did a ethanol precipitation. Then she run it on the gel but still a strong smear.Also, does anyone know that PCR Clean up Purification Kit from Promega company is able to remove protein or not?
2. Then I did once for her as a total volume of 50 microlitre and it turned a very weak band with strong smear.
3. The buffer was TBE, the same for making gel and running gel and worked for other PCR product.
4. I doubt if it is a problem of primer. They have a Tm difference of 4 centigrade. They might degrade...I think. They are being used for about 3 months. But if that's the problem, why it showed the smear?
5. Will it be the problem of my partner's lab skill? But she got good band when she did another PCR and so do I.
6.The programme I used is as followings:
94C 5min,
94C 30s,
46.7C 30s,
72C 1min30s,
go to step2 to for 4 cycles,
72C 8min,
Store at 8C
Then add 2 primers,
94C 3min,
94C 30s,
55C 30s,
72C 2min,
Goto step 2 for 34 cycles,
72C 8min
Store at 8C
7. The primers are CAGCTA/GAGCTC/AAAGAGGAGAAATACTAGATGATTCTG GC% 33.3 Tm 57.04, and ATCGT/CCCGGG/GCTTACTTGTACAGCTCGTCCATG GC%50 Tm61.1

Sorry it is very long description but I was really worried for this one because this fusion PCR stuck us for more than 1 months. I would be really grateful if anyone could give some advice.

Hong,

I have no experience with fusion PCR. BUt smearing usually means loads of unspecific annealing. Since, you have tried increased temperatures of annealing (I have gotten bands at temperatures 15 C above the annealing temperature, worth a try!!!!) and also different quantities of DNA template, its time to reduce primer concentration and also Taq concentration. I would also suggest looking at the primer sequence itself for repetitive sequences and if you are stuck with this problem for almost a month, just change the primers....