qPCR for telomere length measurement - efficiency issues - complicated monochrome multiplex assay with SYBR Green (Aug/17/2010 )
Hi Natalie,
A few notes on reproducibility of results (hopefully I am not repeating things you have already told me or we have already talked about in the above discussion):
1. Be very careful that DNA concentration is the same across all samples. For example, I think that using 10ul of template at 2ng/ul will not work as well as 2ul of 10ng/ul template. I think this is because there tends to be more error introduced in diluting down to lower concentrations.
2. Be careful about DNA quality. Aliquot DNA you intend to analyze multiple times and freeze it so you don't have it sitting in the fridge degrading or multiple freeze thaws of the same sample. Some of my preliminary evidence suggests that freeze/thaw or sitting around in the fridge causes problems.
3. Making mini-master mixes for replicates might also help. That is, I combine my DNA and mastermix for ~3.2x reactions worth in one separate tube and then aliquot out into the qPCR plate using a multichannel into three seperate wells (with the .2x excess to compensate for mix getting stuck on sides of tubes/tips).
4. DTT degrades readily in light and with freeze thaws - if you decide to use it be careful. Also, I have found it helpful to just make my own mastermix using Cawthon's recommendations and make a whole bunch of single-use aliquots.
I didn't try the LightCycler conditions--in retrospect, I think cycling conditions are different on LightCyclers because they go through the cycles faster than a normal thermocycler.
Thanks for the gel images. I wouldn't worry about positives in your negative controls as long as the initial concentrations (i.e. Cq values) are very low.
I had the following correspondence with Richard Cawthon about some of these issues which he said would be ok for me to post here and might be of interest:
"The posted primers eliminate a 4-bp overlap and perfect match at the 3’ ends between one telomere primer and one albumin primer from the MMQPCR paper, which may sometimes cause a problem with a telalb primer dimer appearing.
I’ve changed the albumin primers again however, and now recommend:
Albugcr2
cggcggcgggcggcgcgggctgggcgg CCATGCTTTTCAGCTCTGCAAGTC
and
Albdgcr2
gcccggcccgccgcgcccgtcccgccg AGCATTAAGCTCTTTGGCAACGTAGGTTTC
which contain a few internal mismatches from native sequence, in order to minimize primer dimers. These work great, under the following conditions:
Final concentrations of primers in the PCR:
tel g: 200 nM
tel c: 700 nM
albugcr2: 700 nM
albdgcr2: 500 nM
Thermal profile:
95 x 15 min
-----------------
94 x 15 sec
49 x 60 sec
Repeat for a total of 2 cycles
-----------------
85 x 20 sec
59 x 30 sec
Repeat for a total of 4 cycles (this stage is amplifying the telomere product, without amplifying the scg product)
-----------------
94 x 15 sec
59 x 30 sec with signal acquisition
84 x 30 sec
85 x 20 sec with signal acquisition
Repeat for a total of 30 cycles
------------------
Melting curve (Optional), from 59 to 95 degrees, 0.5 degrees per step, 5 sec per step
Regarding telomere amplicon melting peaks disappearing at high input DNA concentrations: this is due to the GC-rich scg product “stealing” the SYBR Green I. SYBR Green I is not saturating in the reaction (it would inhibit the PCR if it were saturating), and more dye binds as the GC-content of the ds-DNA rises. So if you stop the cycling after you’ve plateaued the telomere amplicon, but when you’ve made only half the plateau amount of the scg amplicon, then you’ll see the telomere amplicon’s melting peak just fine, even in the high DNA input reactions.
I haven’t tried LinRegPCR yet.
My understanding is that having separate standard curves for each distinct amplicon prevents even large differences in amplification efficiency between those distinct amplicons from being any problem at all. However, if one finds that amplification efficiencies for a single amplicon are varying significantly from sample to sample in the same run, then one definitely needs software to correct for those sample-to-sample efficiency differences (or, alternatively, one needs to re-optimize one’s DNA extraction and PCR conditions).
Sincerely,
Richard"
Nathalie Allard on Wed Sep 1 10:03:45 2010 said:
Hello!
I run the PCR product on a 3% gel. ALbu has a product in the NTC which has the same size like the samples. Albugcr NTC is empty. I suppose that the Albugcr primer are nearly on the same place on the sequence because they have the same size on the gel.
To set this method up is not so easy. I'm not getting repducable results! I don't know why the variation between the runs is so high.
Did you try the cycling program for the LightCycler also on the BioRad? If yes, how does it work? This will be my next try for establishing this method. I will also try the selfmade mastermix in the paper. I'm sure that DTT and betaine could be very helpful in the PCR because of the GC clamp.
Attached is a gel I made!
I have been having some problems with edge effects - my melt curves for edge (and especially corner) wells look different than those from inner wells. Cq values also tend to be higher in edge and corner wells, and correspondingly, excluding sample replicates in the edge wells gives me a lower CV. This is using the original albumin/telomere primers in Cawthon 2009. I am considering using the modified albumin primers above which Cawthon gives lower recommended acquisition temps for and/or lower cycling temperatures a bit more.
Has anyone else had problems with edge effects with this assay? I have had the edge effects both using the iCycler iQ and iCycler MyiQ.
Thanks,
Dan
Also of note to those considering using the new scg primers recommended by Richard Cawthon - there is one uncomfirmed SNP (rs75523493) that overlaps with those primer sequences. If this SNP is real, it might cause some noise and perhaps systematic bias.
Dear Nathalie and Dan,
I'm also intending to implement this technique in my new lab. I carefully read everything you have posted above but i'm still trying to spare out some troubles.
My first tries were made with the initial 2004-protocol from R.Cawthon (home-made master mix) and failed. I then go on with Biorad SYBR-mastermix using the following conditions:
_Telomere f: 270nM
_Telomere r: 900nM,
95°, 3min
95°, 15s
54°, 2min, 30cycles (indeed, i increased it)
_AT1 (as SCG) f: 500nM
_AT1 r: 500nM
94°, 3min
95°, 15s
60°, 1min, 40cycles
I used separated plate for tel and SCG
Standard DNA concentration were from 10ng to 0.31ng
I'm using low DNA concentration of 1ng/µL (directly from my stock sample DNA)(I know that it can increase sample to sample variations due to pipetting error!)
After two separate experiments, I found the following results: Tel efficiency at 67 and 65% respectively with R˛ around 0.995, slope around -4.492. AT1 efficiency 88%, 85% respectively with R˛ around 0,994, slope around -3,652. The melting curves were good, indicated no primer dimer or non-specific amplicon. I found out very low sample to sample variations in term of Ct.
Nevertheless, I'm still wondering why I can't reach better tel efficiency?
Thanks again for the already published useful informations and thanks by advance for your answer
Tom
I'm not sure what's up, but hear are a few thoughts:
1. Some people are publishing with low efficiencies and using LinRegPCR to correct for this. The greater than 90% efficiency rule of thumb seems to be just that, a rule of thumb with limited empirical basis. The fact that the E between T and S amplicons are similar is reassuring.
2. The sample you are using to make your standard curve might have inhbitors/enhancers in it. Try to exclude low or high C samples and see what it does to efficiencies. You might also try using different samples to construct your standard curve with.
3. See what kind of well-specific efficiencies you are getting. You might find that those are substantially different than using the standard curve method.
4. Beware of well-position effects--they can cause unpredictable and unstable efficiencies.
5. Ct CVs really don't tell you a great deal. T/S ratio CV is what really matters here.
Tom-S on Thu Nov 25 09:35:41 2010 said:
Dear Nathalie and Dan,
I'm also intending to implement this technique in my new lab. I carefully read everything you have posted above but i'm still trying to spare out some troubles.
My first tries were made with the initial 2004-protocol from R.Cawthon (home-made master mix) and failed. I then go on with Biorad SYBR-mastermix using the following conditions:
_Telomere f: 270nM
_Telomere r: 900nM,
95°, 3min
95°, 15s
54°, 2min, 30cycles (indeed, i increased it)
_AT1 (as SCG) f: 500nM
_AT1 r: 500nM
94°, 3min
95°, 15s
60°, 1min, 40cycles
I used separated plate for tel and SCG
Standard DNA concentration were from 10ng to 0.31ng
I'm using low DNA concentration of 1ng/µL (directly from my stock sample DNA)(I know that it can increase sample to sample variations due to pipetting error!)
After two separate experiments, I found the following results: Tel efficiency at 67 and 65% respectively with R˛ around 0.995, slope around -4.492. AT1 efficiency 88%, 85% respectively with R˛ around 0,994, slope around -3,652. The melting curves were good, indicated no primer dimer or non-specific amplicon. I found out very low sample to sample variations in term of Ct.
Nevertheless, I'm still wondering why I can't reach better tel efficiency?
Thanks again for the already published useful informations and thanks by advance for your answer
Tom
dtae on Thu Nov 25 19:06:28 2010 said:
I'm not sure what's up, but hear are a few thoughts:
1. Some people are publishing with low efficiencies and using LinRegPCR to correct for this. The greater than 90% efficiency rule of thumb seems to be just that, a rule of thumb with limited empirical basis. The fact that the E between T and S amplicons are similar is reassuring.
2. The sample you are using to make your standard curve might have inhbitors/enhancers in it. Try to exclude low or high C samples and see what it does to efficiencies. You might also try using different samples to construct your standard curve with.
3. See what kind of well-specific efficiencies you are getting. You might find that those are substantially different than using the standard curve method.
4. Beware of well-position effects--they can cause unpredictable and unstable efficiencies.
5. Ct CVs really don't tell you a great deal. T/S ratio CV is what really matters here.
Many thanks Dan,
These experiment are very frustating for me as i'm convinced that i'm doing things quite well...! Your remark concerning the use of different DNA to construct standard curve. Concerning the point 4, each time I carefully checked that my samples are always at the same position in pairs for T and S.
I will work on suggestions and keep you (and the others investigators of qPCR for telomeres) inform.
Have a nice week-end
see here for more info on what i mean about well-position effects:
http://www.protocol-online.org/forums/topic/17528-well-position-effects-edge-and-corner-effects-in-qpcr/
I have tried Cawthon's multiplex qpcr method with his newest albumin primers and thermal cycling profile and have found that the albumin gene amplification overlaps with the telomere amplification instead of rising above threshold at a later cycle number than the telomere. In his 2009 paper, the purpose of the multiplex was to thermally separate the two amplifications in the same reaction well, but with these newest primers, albumin amplification occurs at the same cycle number as the telomere and crosses the threshold at the same time as well. Has anyone else used the newest albumin primers posted on this forum and had this problem at all?
I appreciate any response/help. Thanks in advance.
I forget what the problem was, but I got better results with the old albumin primers than the new ones. Are the two products distinct on the melt-curve?
shvir on Fri Jan 14 21:34:43 2011 said:
I have tried Cawthon's multiplex qpcr method with his newest albumin primers and thermal cycling profile and have found that the albumin gene amplification overlaps with the telomere amplification instead of rising above threshold at a later cycle number than the telomere. In his 2009 paper, the purpose of the multiplex was to thermally separate the two amplifications in the same reaction well, but with these newest primers, albumin amplification occurs at the same cycle number as the telomere and crosses the threshold at the same time as well. Has anyone else used the newest albumin primers posted on this forum and had this problem at all?
I appreciate any response/help. Thanks in advance.
The products are distinct, however the telomere amplicon melting peak is lower than it should be for samples. In a previous post where Cawthon's direct response was quoted, he explained how this occurs due to the GC-rich scg product stealing the SYBR Green.
Just to clarify, which "old" primers worked the best for you? The ones published in his paper or the first "new" set of albumin primers previously posted in this forum (albugcr1, albdgcr1)? The "newest" primers I'm referring to with this problem were labeled albugcr2, albdgcr2.
dtae on Fri Jan 14 21:50:46 2011 said:
I forget what the problem was, but I got better results with the old albumin primers than the new ones. Are the two products distinct on the melt-curve?
shvir on Fri Jan 14 21:34:43 2011 said:
I have tried Cawthon's multiplex qpcr method with his newest albumin primers and thermal cycling profile and have found that the albumin gene amplification overlaps with the telomere amplification instead of rising above threshold at a later cycle number than the telomere. In his 2009 paper, the purpose of the multiplex was to thermally separate the two amplifications in the same reaction well, but with these newest primers, albumin amplification occurs at the same cycle number as the telomere and crosses the threshold at the same time as well. Has anyone else used the newest albumin primers posted on this forum and had this problem at all?
I appreciate any response/help. Thanks in advance.
