Blast Nucleotide Issue - No more Gene ID when comparing Bacteria genome (Aug/10/2010 )

Recently, whenever i compare bacteria DNA sequence against the blast nucleotide. using " others (nr/nt) " database, i can no longer obtain the " linkout" or the annotated gene ( gene ID) that supposedly come together with the comparison.

IN the end , i have to open the whole genome.. and take out the genome region that i wan according the the number(BOLDED) from the alignment and find the gene ID/CDS from there.

Query 35 TCGGCCCCGGCACGCCCGGCGGCAATCTGCTGCGTCGTTACTGGCAGCCCGTGGCCCTGG 94
||||||| ||||| ||| |||| | ||| |||| | || ||||| || ||||| ||||
Sbjct 2225376 TCGGCCCGGGCACTCCCTGCGGGCAGCTGATGCGCCAGTATTGGCAACCGGTGGCGCTGG 2225317

The NCBI staff insists that i am wrong. but i know it existed because i been doing alot of blast work before this.

IN this picture that i m uploading.. there's NO darkblue box with G to indicate genebank in the links area.

It's all empty. It used to be there when i did it last month.. and i had the " linkout" box ticked.

you are totally right ...a week ago or so there was a clear link to the gene associated with the hit sequence!

This feature is now missing ...and it was a very important feature to my point of view!!!

I think i should also contact the NCBI support to stress that this feature has to be reactivated!

Regards,
p

pDNA on Tue Aug 10 19:41:28 2010 said:

I did email the NCBI people, after discussing with the developers he said i could turn on "CDS feature" in the formatting option .. but i know it used to be way EASIER!

I wonder why they remove this particularly useful feature. it definitely saves more time.

Let me know what the NCBI people tell you. They usually reply pretty quickly. I was directed to a person called Dr Tao Tao.

Gosh... life is hard, and now become harder...
I use that to find all my required genes, gene names...etc, but now i can't anymore... duh....