blunt end ligation problem - Self ligation and truncate (Jul/16/2010 )

Sometimes I face problems when I did blunt end self-ligation.

I phosphorylated the primers and followed by PCR. I did the blunt end self ligation using T4 DNA ligase. After ligation I got colonies. I purified the plasmid and sent them for sequencing. The results shows that there is a truncate at the ligation point. It did not end to end ligate while it ligate with 3 nucleotide truncated.

Like this:
(for example)
correct one should be:

AAAAAAAATTTTTTTTTCCCCCGGGG|CCCCCCCCCAATTTTTTT
TTTTTTTTTAAAAAAAAGGGGGCCCC|GGGGGGGGAATTTTTTT
But I got like this:
AAAAAAAATTTTTTTTTCCCCCG|CCCCCCCCCAATTTTTTT
TTTTTTTTTAAAAAAAAGGGGGC|GGGGGGGGAATTTTTTT

there are three nucleotide truncated.

Any suggestions why it can happened?

Hi,

If i am not wrong you did overlap extension PCR ? If it is then its common problem repeat once again and get your product sequenced before cloning.


Otherwise check the Purity of your DNA ligase and its buffer.


With Regards,

Mole .