Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Cloning

PgemT-Easy sequencing primers, please rate - I am deciding which primer pairs to use for cloning (Jul/13/2010 )

Hi all,

I am deciding what primers to use to sequence my inserts from the PGemT-easy cloning vector. I want to reduce the unwanted sequence reads (ie or the primers) but get the whole of my 16S insert..as the first few sequence reads are not always reliable I want to choose a primer that is near the edge of the vector ends..but dont want to use a 16S primer sest (such as a 616V, 1492R pair).
The options available are SP6-T7 pair, M13R-M13F pair, or any other primer pairs anyone may have used with success!

Cheers

Manny :lol:

-manny-

I have used
For GATGTGCTGCAAGGCGATTA
Rev CTTCCGGCTCGTATGTTGTG
with good results... But they are a bit farther away from the cloning site (bc that's what I wanted...).

Cheers.,

Minna

-Minna-

Thanks, heaps

M

-manny-