Protocol Online logo
Top : New Forum Archives (2009-): : DNA Methylation and Epigenetics

MSP - unwanted amplification - (Jul/09/2010 )

Hello everyone!

I need help, my MS-PCR (Met) is amplifying unmodified DNA. Using previously described primers. How can?

Thanks

-brazuca-

Can you post the primer sequences here? If they amplfy unmodified DNA, it is likely caused by insufficient non-cpg Cs in the primers and too low annealing temperature.

-pcrman-

Sure pcrman!

Primers:
M Foward 5 TGGTAGTTTTTATGAAAGGCGTC 3'
M Reverse 5 CCTCTAACCGCCCACCACG 3'
Annealing temperature: 56C

Thank you a lot!

-brazuca-

I should have asked you to post the unmodified target sequence so that I can tell how many non-cpg cytosines the primers cover. regardless, the primers are not long enough (23 and 19nt). if you know the original target sequences could you post them here?

-pcrman-

Hi pcrman!
Sorry about the delay, was looking for the sequence and finally found ... also wanted to ask you if you know any web site that simulates the conversion of DNA by bisulfite. (?)

Sequence follows: TGGCAGCCTTCATGAAAGGCGCCGTGGAGAAGGGCGAGGAGCTCTCCTGCGAAGAGCGAAACCTG
CTCTCAGTAGCCTATAAGAACGTGGTGGGCGGCCAGAGGG

Thanks!

-brazuca-

I increased the annnealing temperature and worked

-brazuca-