PCR genomic DNA of high GC content - (Jul/07/2010 )
Hi all,
I'm trying to amplify a 1kb/3kb fragment off of a region of C. elegans genome that has very high GC content. The primers provided are "weird" in terms of having lots of single nucleotide repeats (e.g. aaaa or cccc). I tried a few different mixes (mostly changing Mg concentration and primer/template concentration) at different annealing temperature but the desired bands don't show up at all. Instead, I either get no band or non-specific bands, all of which smaller than the target.
Should I keep working with these primers or design some new ones, or should I just try a few more mixtures/Taq? Any hints or suggestions are welcome. Thanks a lot pplz!!
Add 5% of a 1 M betaine solution.
Or you can with try 5% DMSO... But i think betaine works better.
phage434 on Jul 7 2010, 04:33 PM said:
Thanks!!!
adrian kohsf on Jul 7 2010, 08:24 PM said:
Thanks as well! I'll try both..
What are the actual conditions you're using? Primer sequences? Calculated Tms? For high GC templates, I go with the very basic 4x(G+C) = 2x(A+T) equation; it seems to work well.
swanny on Jul 8 2010, 03:42 PM said:
There are 2 pairs of primers: cagtgcctttagggcttgag/ggggtactgtggctgaaaaa and taaatcaaacgcccttggaa/aaacgaaaacccggagaaat. The Tms are calculated to be around 56 degrees (first pair) and 52 degrees (second pair). The region itself is where the problem is: high GC content and lots of repeats... I've tried betaine like suggested and annealing temperature from 48 degrees to 60 degrees, with combination of various concentration of Mg, primer, template, you name it.. Still, with cheap Taq it shows a crapload of non-specific bands but not the target, and with Hifi Taq there would be no band.
