GAPDH primer design and efficiency problems (new to rt-pcr) - (Jul/06/2010 )
Hi, I was wondering if someone could help me with this. I am fairly new to RT-PCR (and PCR in general) and I'm trying to learn all the basics of primer design and testing.
Recently, I designed a set of GAPDH primers using Primer-Blast but for some reason I am getting extremely high efficiencies when I run a standard curve with these primers. I was wondring if someone could look over the primer sequence and let me know if there may be problems with the sequence itself.
The sequence is:
Fw: TGTTCGACAGTCAGCCGCATCTTC
Rv: GGTGACCAGGCGCCCAATACG
I did a gradient intially with these primers from 55-65 oC and they seemed to be fine at all temperatures but when I ran a 10x standard curve the efficiency was around 135%. I would imagine trying to design reference gene primers would be the easier task but I guess I've been proven wrong.
If anyone could please help me out that would be great.
Thanks!
BTW, would concentration of primers in the reaction mixture affect standard curve?
It would give you primer dimers at the bottom of the gel.
I also designed my GAPDH by primer-blast at NCBI.
use 1.5ul of 10pmol of working solution primers for every 50ul reaction.
Are you doing Real-Time PCR?
cells on Jul 6 2010, 08:01 AM said:
Hi, thanks for the reply.
Yes, I am doing real-time PCR and I had been using 500nM final concentration of each primer in those reactions.
When I did normal gradient PCR, I used 2uL of a 10uM primer solution in a final volume of 50uL...do you think this is too high?
Hi again, would it be possible for anyone to help me check if this primer pair is leading to any gDNA contamination (which could probably give rise to the higher efficiency).
I did a nucleotide Blast with these sequences and I'm getting some E values that are pretty low under genomic sequences...is this cause for any big concern?
