Overlapping PCR - really need help ! - (Jun/08/2010 )
Hey!
I got a big problem with fusion PCR, thats why i am asking
.
Well, i want to fuse 2 Fragments, one with 1,1 kb, and a second with 1,3 kb. So I amplify the original fragments with Phusion-Polymerase, and got a good yield.
Then purification of the product, and starting to fuse them.
The overlapping primers are:
First fragment 3'
CATATCCGTCGACGCATTGAATATTTTATTCCCATTTGTACCCAA
Second fragment 5'
AATATTCAATGCGTCGACGGATATG
Bold is the overlapping region.
Now i tried many combinations with Taq, Phusion, and Pfu Polymerase. Different annealing temps from 52-59 degrees celcius.
With primers added, without primers added. With a lof of template, with less template. Don't know what to do, really need a good advise
.
I am going crazy, somebody can help me
Thank you very much,
Ben
Hmm nobody? If you have an idea, please tell me ![]()
Well, u can try temperature gradient PCR using forward primer of first template and reverse primer of the second template.
The second option would be to design new set of primers : where you need to design reverse primer of first template and forward primer of second template such that both of these primers have same restriction enzyme site. After the PCR amplification of the two templates separately, put the templates for digestion separately. This would be followed by ligation reaction into the vector of choice where you will put both the digested templates and the digested vector. Keep in mind that the common restriction enzyme site which you chose for the above set of primers should be different from the one designed for cloning in the vector.
Best of luck!
Hi, just curious, did you purified both your fragments before doing fusion PCR? Using column or gel? If not, you might as well consider try both or either purification to see whether it helps.
Good lucks.
You should be able to go from the initial PCR reaction without cleanup. Take 1ul of each reaction, and set up a fresh reaction, but without the primers. Do 5 cycles of this reaction, then add terminal primers for the complete product.
Have you increased the extension time appropriately?
hi
i have the same problem .when for first time i used pfu polymerase it showed a faint fused band (1.2+1.7+1.6). i had carefully designed my primers,they worked very well on gdna .i got disappointed. working on another project, i kept all gel purified fragments in -20 for five months up to now. i decided to try again but now i get only smears with no dimer primer. actually i think it may be related to purity of fragments and all stocks should be fresh.i'm not lucky because i realized my new ordered pfu has been probably damaged during shipment. i don't know really what to do! i would be glad if u had some success plz send me the condition you used.
