Please help me if you could - (May/26/2010 )
I want to design premirs ( for RT-PCR)
of TELO2 protein. I am not familiar with this action
but I followed steps
from some websits
.
I want to check if what I got is correct or not
. Could any body go through this action to show me the correct primers please
.
This is what I got
Name Sequence Strand Position Tm °C Purity Modification
Primer Set 1: Amplicon Size = 80
query_L1 ATTCATGCCCTCTCGTCTTC forward 337 59.24 GAP
query_R1 ATCTCACCGAGATACCGCTT reverse 397 58.77 GAP
query_P1 AGATGTGGCCGCCATCCTCC reverse 357 68.96 HPLC 5'Fam - 3'Tamra
Primer Set 2: Amplicon Size = 107
query_L1 AGAACTACTTCCGCCTGCTC forward 836 58.70 GAP
query_R1 GACCTGAGACACGAAGGACA reverse 923 58.80 GAP
query_P1 CAGCACCCGGACGACCTCCT reverse 860 69.25 HPLC 5'Fam - 3'Tamra
Primer Set 3: Amplicon Size = 144
query_L1 CTGACCACGTCTGAGGACAT forward 1855 58.67 GAP
query_R1 CACACAGGTCTTCTCCTCCA reverse 1979 58.80 GAP
query_P1 CCCACAGCCACTCGGGAGGT forward 1927 69.15 HPLC 5'Fam - 3'Tamra
________________________________________
I asked someone and she said I got wrong premirs
because I put all DNA sequence.
Ans now I have to put just exons if any one has knowledge with it please just help
How to do it. I will put my sequence if any one can help me
.
nana_0a on May 27 2010, 10:14 AM said:
Ans now I have to put just exons if any one has knowledge with it please just help
How to do it. I will put my sequence if any one can help me
hi,
Generally for RT pcr u need to design primers form the exons ie, the coding sequence, that u can find as "CDS" in ur mRNA sequence.
Thank you so much.
But how can I get the sequence of my gene telo2 without introns just exons.
if you have any good website, please tell me. ![]()
There are at least two ways I know of.
First using Ensembl database, to search for your gene and after selecting corresponding transcript choosing cDNA from the menu. Like this for human TELO2. (You can use Configure this page to change settings to display mRNA or CDS only. Or you can select Exons view to display sequence of both exons and introns separated).
Second way is to find human TELO2 on the Entrez Gene database, and find the reference mRNA sequence (in Genomic regions, transcripts, and products part, the blue link "mRNA links") in FASTA format.
Thank u so much for your helping ![]()
