PCR product appear two close band in my gel - (May/22/2010 )
Can you give us the sequence of the 305bp fragment as well as the primer's? Maybe the primers binds inside your fragment, even if it's only a few bp.
Here it is: upper case letters represent primers
TGTGTGTGTGGGGTCTGTCT TGTGATGAAAGAGGCCAGAA TGTGTGTGTGGGGTCTGTCTctccatggctgacagtgcacatgtggattc cagggctcaggatgctgttgctgggagctgttctactgctattagctctg cccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcc
cctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatc cgggccataatggggccccaggccgtgatggcagagatggcacccctggt gagaagggtgagaaaggagatccaggtaagaatgtTTCTGGCCTCTTTCATCACA
Here it is: upper case letters represent primers
TGTGTGTGTGGGGTCTGTCTctccatggctgacagtgcacatgtggattc cagggctcaggatgctgttgctgggagctgttctactgctattagctctg cccggtcatgaccaggaaaccacgactcaagggcccggagtcctgcttcc
cctgcccaagggggcctgcacaggttggatggcgggcatcccagggcatc cgggccataatggggccccaggccgtgatggcagagatggcacccctggt gagaagggtgagaaaggagatccaggtaagaatgtTTCTGGCCTCTTTCATCACA
I`d appreciate any comments....
Could you try decreasing the Mg concentration to 1mM? More Mg means less specificity/higher activity, while lower Mg concentration means more specificity and less enzyme activity.
you could try digesting your template DNA with one or more restriction enzymes which cuts outside the region you want to amplify. That should hopefully remove any secondary primer binding sequence.
Lastly, what actually do you want to do with that PCR product? You must always remember why you are doing what you are doing. If this is for cloning, a perfect PCR is not required. Only something which is good enough.
Just gel purifying on 3% agarose, and once the fragment has been inserted, screen several colonies by RE and DNA sequencing for the correct insert.
Thanks for the input, i need the PCR to do RFLP, the thing is that i cant do the resrtiction reaction until i optimize my reaction to get single band as the expected band obtained after digestion migh interfere with the second band i got after PCR, they almost have the same size 80-90bp.
Hmm... another thing you could do is to purchase another set of primers (or maybe more) which anneal to slightly different positions on your template. Primers are cheaper nowadays. And sometimes a set of primer will simply not cooperate.
With the new set of primers, you can design them to have a minimal difference in melting temperature (tm)
