Taqman probe not easily synthesized - What sequence features make probe synthesis difficult? (May/12/2010 )
I have tried to order a taqman probe
ACAACGGCATGATGTTTACTGTTGCTGATTTA
that is 38% GC, and has one possible self - complementary stretch (CAAC ---- GTTG) .....
- The probe vendor says that the synthesis has been difficult and if I could figure something out about the sequence I might be able to modify it so that we can make the probe. Any help here?
-patty
I found this tip:
6. Runs and repeats: The probes should not have runs of identical nucleotides (especially four or more consecutive Gs), G+C content should be 30-80%, there should be more Cs than Gs, and not a G at the 5' end.
I see that my probe has more Gs than Cs. I chose this particular probe because Primer Express recommended it. Any reason I should not try to synthesize the reverse complement? Also, if I go shorter, (trim 2 nucleotides with a resulting drop in Tm) then maybe they can sythesize the thing as a full length probe. But, the Tm would be lower.
Help?
As things stand, the probe is difficult to synthesize and the background fluorescence is crazy high. I can still see my amplification curves, but just barely and the Ct's are not reproducible one run to the next.
Your probe is too long (32bp). I understand you want Tm 70°C and you have it so long because it is AT-rich. Solution to this is to choose the shorter probe in another region or if you cannot move to another region then order shorter variant of this probe but with LNA - locked nucleid acids or MGB which will incerase probe Tm even if it is short.
Anyway, I think that good manufacturer should synthetize your original probe without discussion - try Sigma-Aldrich for example.
vladooo on May 13 2010, 01:37 AM said:
Anyway, I think that good manufacturer should synthetize your original probe without discussion - try Sigma-Aldrich for example.
Well, they did synthesize it without discussion (on the third try), I went back about a month after receiving a mediocre synthesis to ask them why it was not as high quality as the other probes they produced for us and they said it was difficult to synthesize. So I came here to see if there was something I could do to improve it.
Interseting about the length, thanks, and the tips about working with a shorter probe. I will make a note.