PCR of AT rich gene - - I am having trouble amplifying an AT rich sequence (Apr/23/2010 )
Hi there
I am trying to amplify an AT rich sequence - though so far have been unsuccessful. My major problem is that I do not have enough DNA to run endless PCR's to account for every variable, so I am trying to narrow it down to the conditions that are likely most favourable. I am trying to amplify a gene from Carsonella, and the DNA has been extracted from the bacteriocyte, so that both the insect and Carsonella DNA are present in my sample. Are there any implications of this that I may not be aware of?
The forward and reverse primers im using are (5-3 direction):
F= CACCATGTATAATTTTGTTGCAATAATTACTCCTTATAATG (CACC added to aid cloning into topokit)
R = TCAAATCTGACTTTGGGTAAAATAAAAATTATTTATATC
I have tried out a few servers and there appears to be some secondary structure but if I work with annealing temperatures around 54C I am hoping to avoid these structures. I am also not sure how to interpret he MFE given in kcal/mol- and how I can use this to determine the melting temperatures of the secondary structures. I have presently been using phusion polymerase, but may switch to Taq if it allows me to drop the extension temperature down more. Does anyone know what the salt concentration in the HF buffer supplied with phusion is? As I believe this will have an impact on my primer Tm.
The parameter I am least sure about is the Mg concentration, which I'm told can be critical. I am currently using 1.5mM, and I wonder if there is anything obviously wrong with this- given my AT rich sequence.
I'm rather new to PCR, and if anyone has any helpful suggestions- they would be greatly appreciated!
thanks
Make sure you read this:
Reduced extension temperatures required for PCR amplification of extremely A+T-rich DNA.
Su XZ, Wu Y, Sifri CD, Wellems TE.
Nucleic Acids Res. 1996 Apr 15;24(8):1574-5. PMID: 8628694
phage434 on Apr 23 2010, 06:57 PM said:
Reduced extension temperatures required for PCR amplification of extremely A+T-rich DNA.
Su XZ, Wu Y, Sifri CD, Wellems TE.
Nucleic Acids Res. 1996 Apr 15;24(8):1574-5. PMID: 8628694
Hi there
yes thanks I had read the paper, and am planning on running the PCR with the lower extension temperature as per the results of the paper. Do you have any ideas/advice on any of my other concerns?
thanks very much
Sarah
There is a potential problem in self-dimer formation with the F primer. You might want to extend it one or more bases to eliminate the self priming at the 3' end.
: |||||| :
3' GTAATATTCCTCATTAATAACGTTGTTTTAATATGTACCAC
Unless you really need the accuracy, I would recommend starting with a Taq or Taq + Pfu mixture rather than with Phusion. Taq tends to be a bit more forgiving in amplification.
Try a gradient pcr to get the annealing temperature correct. Do you have a positive sample you can get the pcr conditions correct with?
Make sure you do not inhibit the pcr with high volumes of your template DNA. Try 10x and 100x dilutions of template.
You might also try nested or semi-nested pcr if things remain difficult.
phage434 on Apr 24 2010, 07:37 AM said:
: |||||| :
3' GTAATATTCCTCATTAATAACGTTGTTTTAATATGTACCAC
Unless you really need the accuracy, I would recommend starting with a Taq or Taq + Pfu mixture rather than with Phusion. Taq tends to be a bit more forgiving in amplification.
Try a gradient pcr to get the annealing temperature correct. Do you have a positive sample you can get the pcr conditions correct with?
Make sure you do not inhibit the pcr with high volumes of your template DNA. Try 10x and 100x dilutions of template.
You might also try nested or semi-nested pcr if things remain difficult.
The only positive control I have is with a random E.coli gene- but not with an AT rich sequence like the one I am trying to amplify. To avoid this self-dimer- do you know what annealing temperatures I should try and work above? What does 10 and 100x dilution of template equate to in ng per reaction? How many ng would you suggest I work with?
Thanks!
