All cytosines are methylated!! - (Feb/01/2010 )
Hello,
I did PCR using my treated plant gDNA using the following primers and obtained clear bands. I cloned and sequenced and saw there are no C to T conversions! But the mystery to me is that the universal methylated control I used in conjunction with Methylation-Gold Kit seems to be showing the conversion.
Promoter region of my gene:
AAGGCGATATTTGGTGAAAAAGAATGGTACTTCTTTAGTCCTAGAGACCGTAAGTACCCAAATGGATCCCGACCCAATAGGGTTGCCGGGTCTGGGTATTGGAAGGCCA
CCGGTACTGATAAAATTATCACATCAGATGGACGTAAAGTAGGTATCAAGAAAGCTCTCGTCTTTTACATTGGCAAGGCCC
CAAAAGGAACCAAAACTAATTGGATCATGCATGAATACCGCCTTATTGAATCCTCTCGCAAACATGGAAGCACGAAGGTAC
CAACGAAAGAAATTCCACCTGCAGATTAATTTTAATTTGTTTTGATACGCCTCAATATTAATTAATGATTTTTGTTAATTT
TCTTTGTTGTTACAGTTGGACGAATGGGTATTGTGTCGGATTTATAAGAAGAAAT
Primers used
Forward: AAGGYGATATTTGGTGAAAAAGAATGGTA
Reverse: ATTTCTTCTTATAAATCCRACACAATACCCATTC
It would be very helpful if someone could help me with this. My question is as to why there is no C to T conversion. Is it possible that all Cs are methylated?
Thank you in advance! I'd appreciate any suggestion.
There are two possibilities:
1. Your DNA was not converted.
2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.
Thank you very much for your reply. I really appreciate it.
pcrman on Feb 17 2010, 10:32 PM said:
1. Your DNA was not converted.
2. The primer design appears to me to be bad because neither primer contains sufficient non-cpg 'C's, thus allowing no discrimination against non-converted DNA. This possibility is more likely.
Test your primers also on genomic DNA, good BS specific primers dont give a product. And indeed BS primers should at least contain 3 non CpG "C" and for sequencing preferably no CpG sites in the primers.
best
et2b
I agree with the others with regard to the primer design.
But also, plants have non-CpG methylation as well so how would you be able to tell that from non-conversion?
Nick
