Tool to search for motifs within microRNAs? - I need to find microRNAs with common motif (Jan/19/2010 )
Would anybody know any software or online tools that can give me a list of mature microRNAs with a common motif? In other words, if I search on a particular sequence (e.g. AUCCGU) I would like a list of all mature microRNAs that contain this sequence.
Many thanks.
WebLoGo can do what you wanted. For example, i input the following miRs to find potential motif.
UGAGGUAGUAGGUUGUAUAGUU
UGAGGUAGUAGGUUGUGUGGUU
UGAGGUAGUAGGUUGUAUGGUU
AGAGGUAGUAGGUUGCAUAGUU
UGAGGUAGGAGGUUGUAUAGUU
UGAGGUAGUAGAUUGUAUAGUU
UAGCAGCACAUAAUGGUUUGUG
UAGCAGCACGUAAAUAUUGGCG
CAAAGUGCUUACAGUGCAGGUAG
UAAGGUGCAUCUAGUGCAGAUAG

But Weblogo requires all sequences to be equal length.
You can also use the MEME program http://meme.sdsc.edu/meme/cgi-bin/meme.cgi
Thanks Pcrman, that's a nice online resource.
Thanks for the resource, but I have it figured out in Excel.
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
Baars01 on Jan 28 2010, 09:00 AM said:
This simply involves retrieving all miRNA sequences from www.microrna.org and listing them in Excel. Using filters you can remove all non-human miRNAs. Using formulas the hexamer at the 3' end can be retrieved and subsequently matched with a defined sequence.
Can you give an example for your formula in excel, so we can get an idea how you do it?
1. Download the entire microRNAome from www.microrna.org
2. Copy/Paste into Column A in Excel. You will have a column of sequences with above each sequence its FASTA name.
3. In Box B1 enter "=A2" (without "") and expand down to the end of the list. This will add the sequences next to their FASTA name.
4. Apply a filter to Column A and filter for anything containing "hsa". All human sequences will then be shown in Column B. Copy/Paste filtered Column A and B to a new sheet (Remember Paste Special -> Values only)
5. In box C1 of your new sheet input the following formula "=Right(B1,?)". Replace ? with the amount of bases you want to count up from the 3' end. Expand this to all rows.
You now have your desired sequence set in which a motif can be found using Ctrl+F
Alternatively, "=Left(B1,?)" can be used to single out sequences from the 5' end. A combination of both can give you desired sequences within the microRNA.
