Protocol Online logo
Top : New Forum Archives (2009-): : Molecular Cloning

Luciferase GL4 siRNA - (Jan/06/2010 )

I will use the B16-F10-luc2 (pGL4 luc2 Lentivirus) cell line for in vivo imaging to study the siRNA delivery using new vectors. So I would like to knock down the luciferase signal. Do you know if commercial siRNA are available for the pGL4 promoter (I can’t find anything in the literature) or is the Luciferase GL3 siRNA will work?



Thank you for your help,

Regards,

R

-rimsky-

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin

-KevinK-

Dear Kevin,

Thanks for your reply. Is this duplex available?

Kind regards,

Ludovic

KevinK on Jan 6 2010, 03:44 PM said:

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin

-rimsky-

Dear Kevin,
I would like to know if you have a protocol that you can give me for the transfection of this cell line (Did you used any transfectant?)?

Thanks,
Regards,

R


rimsky on Jan 6 2010, 04:41 PM said:

Dear Kevin,

Thanks for your reply. Is this duplex available?

Kind regards,

Ludovic

KevinK on Jan 6 2010, 03:44 PM said:

Dear Rimsky,
The siRNAs directed against the luc+ gene found in pGL3 will not likely work well for the luc2 gene in pGL4. We have tested a number of sequences in house here at Promega and found the following duplex to work the best of those tested, giving 80-90% knockdown;
GGACGAGGACGAGCACUUCUU

UUCCUGCUCCUGCUCGUGAAG

We hope to publish this on our website in the near future. Please let me know if you ahve any additional questions, and always feel free to contact Promega Technical Services.

Kind Regards,
Kevin

-rimsky-

Rimsky,
Our work in finding the siRNA sequence was in HEKs93 cells. I am getting the details of the transfection for you, but these will liley not be the same conditions needed for your B16-F10 cell line. Do you need a plasmid transfected or the siRNA? My understanding from your first post was that you were studying siRNA delivery. Are these oligos or plasmid driven?

Thanks,
Kevin

-KevinK-

Kevin,
Sorry for my late reply. I will used oligos.

Thanks for your help.

Rimsky

KevinK on Jan 22 2010, 05:37 PM said:

Rimsky,
Our work in finding the siRNA sequence was in HEKs93 cells. I am getting the details of the transfection for you, but these will liley not be the same conditions needed for your B16-F10 cell line. Do you need a plasmid transfected or the siRNA? My understanding from your first post was that you were studying siRNA delivery. Are these oligos or plasmid driven?

Thanks,
Kevin

-rimsky-