trouble amplifying 2.5kb product from genomic DNA - (Jan/05/2010 )
Hi all,
I am studying the effects of a mutation located in the poly(A) signal in the 3UTR of my favorite gene. I believe that this mutation will result in a longer 3UTR since the polyadenylation complex should continue along the message until a functional poly(A) signal is encountered. I have already successfully cloned the mutated 3UTR into an expression vector and now I intend to add additional downstream DNA (up to the next poly(A) signal) to this vector to test my hypothesis.
I am attempting to amplify this 2500bp region from genomic DNA extracted from HEK293T cells while introducing a 5' SacII restriction site. Thus far I have only gotten non-specific smearing which tends to "fade" with increasing Tm and decreasing annealing times and no band of interest. I am using ~200ng DNA template and Phusion polymerase. I have double-checked the primers and they seem fine. The Tm of both are 61c WITHOUT the SacII portion of forward primer.
I have two questions. First, the introduction of SacII (CCGCGG) to the forward primer significantly increases the Tm of the primer. I am disregarding this increase during the PCR reaction. Is this a potential cause of my problem?
Second, XbaI cuts a region of this genomic DNA that should give a 5100bp product that encompasses the target sites of my primers. Methylation sensitivity of XbaI aside, would it be a good idea to cut with this enzyme, run the DNA on a gel and purify the 5100bp band to use as a template for PCR?
Thanks in advance for any suggestions you may have.
maybe you can provide the whole sequence of your primer?
Could be due to a hairpin caused by the SacII-overhang? ...did you included some extra-basepairs after the restriction site?
I would suggest to do a nested PCR, this will decrease the smear!
Regards,
p
pDNA on Jan 5 2010, 02:38 PM said:
Could be due to a hairpin caused by the SacII-overhang? ...did you included some extra-basepairs after the restriction site?
I would suggest to do a nested PCR, this will decrease the smear!
Regards,
p
F CCGCGGAACGCCAGTGCAGGCTACTG
R TGTGCTGTGTGCTGGGATTACAGG
these primers should amplify a region directly downstream of TP53 3UTR
ACCGCCAGT is the sequence beginning directly after UTR, so I did not include extra basepairs.
I am currently titrating Mg2+ concentration in two different buffers to see if that helps.
you will need at least 3 bp after the SacII RE-site for the enzyme to work!!!
Watch the technical references at NEB.
So will run into serious problems when cloning this fragment!
Regards,
p
