insert sequence in clone - (Dec/19/2009 )
Hi everyone,
I tried to clone my insert into pET15b and i managed to clone my insert into it. But when i sequence my clone there is an additional 7bp in my insert. This additional sequence is in my insert sequence. Why is there an additional sequence in my insert???
Thank you
Hi Jason, where has this insert come from.........i mean, is it a PCR product or from another vector???
Hi,
The insert is from pGEM, i clone my insert into pGEM then digest them and ligate into pET vector. All my insert sequence are inside my clones, but there are an additional 7bp in the sequence which is not meant to be there. This clones are in DH5alpha.
correct insert sequence: CTATGGGCTATGGCGGCAATCAT
clone insert sequence : CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGG------------CGGCAATCAT
Why is there an additional GCTATGG in my clone insert??
Thank you.
jason0429 on Dec 20 2009, 01:52 PM said:
The insert is from pGEM, i clone my insert into pGEM then digest them and ligate into pET vector. All my insert sequence are inside my clones, but there are an additional 7bp in the sequence which is not meant to be there.
correct insert sequence: CTATGGGCTATGGCGGCAATCAT
clone insert sequence : CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGG------------CGGCAATCAT
Why is there an additional GCTATGG in my clone insert??
Thank you.
hmm........u hv got it within the insert....weird........i thought that if its at the end, then it probably is from the previous vector itself....What about the sequence in the pGEM vector? is that correct? or while doing the PCR initially, u may have actually amplified another similar sequence.....is there a likelihood of that happening??
jason0429 on Dec 20 2009, 02:22 AM said:
Yes, but how did you get the original insert that you cloned into pGEM? Was it by PCR? Do the seven bases you're finding in your pET clones exist in the pGEM clones? How big is your insert, and where on the insert do these seven bases appear? Are they within an orf?
What are you comparing the sequence of your pGEM clones to? How do you know the "correct" sequence is correct?
jason0429 on Dec 19 2009, 11:22 PM said:
The insert is from pGEM, i clone my insert into pGEM then digest them and ligate into pET vector. All my insert sequence are inside my clones, but there are an additional 7bp in the sequence which is not meant to be there. This clones are in DH5alpha.
correct insert sequence: CTATGGGCTATGGCGGCAATCAT
clone insert sequence : CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGGGCTATGGCGGCAATCAT
CTATGGGCTATGG------------CGGCAATCAT
Why is there an additional GCTATGG in my clone insert??
Thank you.
so you have a repeat/expansion introduced by instability in bacteria or during PCR if your insert cloned into pGEM was a PCR product...or the original ref sequence was incorrect.
the GGGCTATGG was simply repeated. use a proofreading polymerase...but it isn't always a guarantee.

I have checked the sequence in the pGEM, it has no problem at all. The insert inside the pGEM has the correct sequence. But why when i clone them into pET15b vector the insert sequence have additional bp?? There are no problem with the insert inside the pGEM, I have checked 3 times already. I have been trying to clone my insert into pET15 for 5 months already. Until now i still couldnt get it. What could be the problem?
Thanks for replying me and helping me. I really appreciate alot.
Thank you very much.
