problem with cloning PCR - can't amply the full-length cDNA with PCR (Nov/22/2009 )
Hi, can anybody here help me with my cloning PCR?
I'm trying to clone full-length mouse PARP-1 (NM_007415) into pCMV-3tag-2A (3045bp for coden region). I use the cDNA from mouse liver and spleen as template and the expression levels were checked with RT-PCR (it highly expressed in both samples. But I can't amply the full-length PARP-1 cDNA while I tried every method I can figure out. Following are the conditions I used:
Primers: forward (add Hind III site) 5' at AAGCTT TGCAGCACGAGAAGGAGGATGG 3' since there are a lot of GC at the begining of this gene, I pick up the sequence before ATG as forward primer.
reverse (add Xho I site) 5' at CTCGAG ccacagggatgtcttaaaattgaacttg 3'
PCR component (20ul) cDNA 3ul, primers (10uM) 0.5ul each, dNTPs(10mM) 1ul, Taq 1.5 U, Mg2+(25mM), 1.2ul
PCR conditions: 95 3min followed by 95 20s, 60 30s, 72 4min for 40cyles, then 72 for 10min.
the PCR conditions I tryed: 1) annealing temp 52C 56C, 58C, or 60C; 2) Mg2+ conc 1.5mM, 2.0mM, 2.5mM
3) DMSO 0%, 5%, 10%
But every time I can't see anything when I run agarose, even the smear I can't find either! The only thing I can see is the dimers when I lower the PCR condition. I used several primer tools to analyze the primers and was told the primers are not too bad.
I'm so frustrated by this and hope any specialists here can help me out. Thanks a lot!
I would start by making the cycling conditions longer - use 1 minute for each step rather than the 20" 30", and 4' that you have. Taq is also not the best choice for long templates, try something like KOD polymerase or Phusion. You will also need a proofreading polymerase to make it much more likely that you have the correct sequence when cloned.
Also note that you need to add some bases before your restriction sites on the primers as the RE's usually won't work right at the end of sequences...I think Promega has tables of the appropriate bases and how many need to be added in their "Cloning protocols and applications guide".
I would suggest try your annealing time to "1minute" or "1minute 30 seconds", and reduce your extention time to 3minutes. Try with your genomic before cDNA. Usually 30-35b cycles will do.
p/s: I'm didn't do anything on mouse before, however I just want to know Is there a possibility that your dimers is actually your "sliced mRNA" pcr products?
hello,
i hope one or the other person will help out from my problem.
okay whats the problem is am cloning plk1 as insert of 1.8kb and pcdna3 as vector of 5.4 kb but all the time something else a very very small fragment is cloning and sometimes nothing than vector is seen.. i dono wat the problem is but tried many methods and changes in protocol, but of no use.. could any one help me out from this please.
Alekhya
Hi Alekhya,
I assume after you run your PCR, you purified your PCR using gel, and then excise your band out, recover and clone in your vector. Am i right? If your could show your gel and give more details would be helpful.
Adrian
Thanks bob1 and Adrian. I did use KOD for the cloning first. I tried to use regular Taq as I want to get the bands and then to adjust the conditions to fit the handle. what means "sliced RNA", is this the gene splicing. if so, I checked the Pubmed and didn't find any report.
I will change annealing time to 1:30 as these are suggest by both of you. Hopefully I can get the bands.
Hi Jeffery,
Do let us know your outcome.
Good luck.
Adrian
