Difficulties cloning by PCR - (Oct/12/2009 )
Hello, Good Morning to all,
I find in difficulties in cloning full length of Tobacco cDNA, about 1764bp.
PCR system I used is
for 20ul,
10xPCR buffer 2ul
dNTP 1ul
primer 1/1ul
cDNA as templates 1ul
taq 0.5ul
H2o 13.5ul
Primers I used is
5'-atggcatctttttctgttaaattctcagc-3'
5'-ttaatcttctgcttcttctctttctc-3'
Its Tm and GC % is 57C, 59C and 34%,...., respectively.
Reaction Program is as follows:
95C 5min
95C 45s
Tm
72C 2min
34Cycles
final extention 72C 10min
Here, Tm I used is between 55-65C, 58-66C, 55C.
I also tried to clone it by using Touchdown PCR.
Reagent system I used is
10x PCR buffer 5ul
dNTP 3ul
Primers 1/1ul
taq 0.5ul
cDNA as Template 1ul
H2O 38.5ul
Program is as follows:
95C 5min
95C 1min/45s
TM 1 45s
72C 2min/1.5 min
2 Cycle
95C 1min/45s
Tm 2 45s
72C 2min/1.5min
30 Cycles
72C 10min
Here, Tm 1 = 57C, 58C, 60C, 62C, 63C , respectively
Tm 2 = 55C, 56C, 58C, 60C, 61C, respectively.
from last 3 months until now,
I didnt get any bands.
I hope U can solve my serious difficulties.
Thank you very much!!!!!!!
Hi,
I supposse that the amount of primers, template and dNTPs are the correct ones because you talk in uL terms and it would be easier to talk in mass or molar terms. Anyway, have you rigorously checked your primers sequences? is the template nucleotide sequence the one you thought it is?
I agree with celvas, what are your primer and dNTPs concentrations? Also, what is your template concentration and how is it prepared? finally, what about MgCl2 ? do you use any at all, and what concentration?
I would try different concentrations of primer, template and MgCl2 on a gradient PCR (which I'm assuming it is what your first protocol is) and take it from there. Also, how GC rich is your template? You might need to add some additives such as DMSO or betaine.
Do you have a positive control? Even if is different template and primers, at least to confirm that your PCR reagents actually work?
I've just seen what I assume is a typo, or me understanding it wrong but what does: "primer 1/1ul" exactly means? is that 1ul of primer 1, if so, where's primer 2? Is it 1ul of each primer, again what concentration? what do you mean by 1/1ul???
Can you amplify anything else from the cDNA? How do you know it has good DNA? I would have redesigned primers two weeks ago, and you should do it now. You desperately need some controls to tell you where the problem is. Taq would not be my first choice of enzyme. I would be using a Pfu + taq mixture. Moving to a premix eliminates a lot of potential problems by reducing the number of variables. We start with PCR Supermix High Fidelity from Invitrogen, but many others would give similar results.
If you're getting no bands at all, it's most likely a primer problem, unless your template is no good. Do you have another set of primers that would amplify from this template? If both reactions fail, it's likely your template causing the problem, if the second PCR works and your original one still doesn't, it's probably your primers.
BTW, Primer3 calculates that your first primer (atggcatctttttctgttaaattctcagc) has a Tm of 65.6 °C, and your second primer (ttaatcttctgcttcttctctttctc) has a Tm of 58.2 °C -- this is a huge difference in Tm's, and might be the cause of your difficulties. If you drop four 3' bases from the first primer (thus making it a 25-mer: atggcatctttttctgttaaattct), the Tm is 58.7 °C, a much better match for your second primer.
Completely agree with phage and homebrew... I think I answer a bit to quickly before and forgot the obvious
redesing primers!!! and check the template.
