This is a cached page for the URL (http://tfbind.hgc.jp/).
To see the most recent version of this page, please click here.
Protocol Online is not affiliated with the authors of this page nor responsible for its content. About Cache
TFBIND INPUT
TFBIND
Please input your sequence in FASTA format, e.g. > COMMENTS ACATCTGCTATAAAATACGATGCAGTCACGT TFBIND : Software for searching transcription factor binding sites (including TATA boxes, GC boxes, CCAAT boxes, transcription start sites (TSS)). This tool uses weight matrix in transcription factor database TRANSFAC R.3.4 developed by Dr. Wingender et al, and the cut-offs originally estimated by our research.
Dr. Tatsuhiko TSUNODA Ph.D.(Medicine) & Ph.D.(Eng.) Laboratory Head, SNP Research Center, RIKEN 1-7-22, Suehiro, Tsurumi, Yokohama, 230-0045, JAPAN E-mail: