Protocol Online logo
Top : New Forum Archives (2009-): : DNA Methylation and Epigenetics

Primer designing for Methylation - (Feb/27/2013 )

I want to identify a set of primer sequences which has been used for many years within the promoter region of that gene.

The primer in question is standard MGMT promoter region primers for methylated and unmethylated regions:

1

MGMT (MSP) unmeth F
TTTGTGTTTTGATGTTTGTAGGTTTTT
2

MGMT (MSP) unmeth R
AACTCCACACTCTTCCAAAAACAAAACA
3

MGMT (MSP) meth F
TTTCGACGTTCGTAGGTTTTCGC
4

MGMT (MSP) meth R
GCACTCTTCCGAAAACGAAACG

I am unable to find these sequences within the gene promoter region, the genbank id of which is X61657.

It be very helpful if someone could help me out with it.

Thanking you
Jeru
Ph.D Scholar,
Dept. of Human Genetics,
NIMHANS

-jerumm-

Hi Jeru,

I don't know if you are aware that bisulfite PCR primers are designed on bisulfite modified DNA. It is not very easy to find the exact location of a MSP primer on DNA without modifying the DNA. For M primer, you need to first convert all non-cpg C's to T, and then search the primer in the sequence. For U primer, convert all Cs to T, and then search for the primer sequence.

You can use a text editor or Word to modify the sequence. If you only change non-cpg C to T, you can first change "CG" instance to "DG", then change all C to T, then change DG back to CG.

-pcrman-

If you are searching for a methylated primer sequence on non-bisulphite converted DNA, you won´t find it. Try Methyl Primer Expres software.

-lmg-

Hello Sir,

Thank you for the immediate reply.
I am aware of that, so my how do we find the exact region which is amplified in the product.
I wanted to design primers to check the methylation status of another region within the promoter sequence, the reason for this query

-jerumm-

The primers are usually designed on primer sequences or within CpG islands which often appear in promoters. To find promoter sequence, please take a look at this post
How to find promoter sequence for methylation study

http://www.protocol-online.org/forums/topic/5063-how-to-find-promoter-sequence-for-methylation-study/

-pcrman-

Thank you Moderators and IMG, your information was very useful.

I have an other query, what are the factors which are to be considered for selecting an optimum MSP primer?

-jerumm-

jerumm on Mon Mar 4 11:42:14 2013 said:


Thank you Moderators and IMG, your information was very useful.

I have an other query, what are the factors which are to be considered for selecting an optimum MSP primer?


Hi Jeru,

I put the link to the publication dealing with methyl-specific PCR primer design

https://www.ncbi.nlm.nih.gov/pubmed/12424112.

-rakun-