Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account
  2. → Viewing Profile: Posts: DELETEMYACCOUNTPLEASE

DELETEMYACCOUNTPLEASE

Member Since 27 Jan 2009
Offline Last Active Sep 27 2012 12:16 PM
-----

Posts I've Made

In Topic: Choice of programming language

14 September 2012 - 11:21 AM

Get yourself learning perl or programming perl aka the camel book. Avoid the x for bioinformatics.

Confusing fortran and c++ ... Sound like you should've used an IDE ;)

In Topic: Programmes

13 September 2012 - 01:03 PM

Don't use capitals for variable names, use snake-case, unless you are defining constants. If you are going to do perl make sure you start using strict.

use strict;
my $dna = 'aaaaaatcgCCGGTTaaAT';
print "my DNA: ", $dna;

You don't need exit. I also can't remember print niceties for perl, I think perl allows variables to be embedded within double quotes....

you can:

perl
use strict;
my $dna = lc 'aaaaaatcgCCGGTTaaAT';
print "my DNA: $dna ";

python
dna = "ATCGACTCGAGTCAGCATCGA"
print "my dna:", dna.lower()

ruby
dna = "ATGAGATAGATGTC"
puts "my DNA: #{dna.downcase}"

downcase, oh ruby ...

scala
val dna = "ATGCGGCCGGG"
println("My DNA: " + dna.toLowerCase)

clojure
(use '[clojure.string :only [lower-case]])
(def dna "AGAGTCTGTC")
(println "My DNA:" (lower-case dna))

haskell (in repl)
import Data.Char
let dna = "ATATGATGAT"
"my dna: " ++ (map toLower dna)

In Topic: starting with perl

12 September 2012 - 10:50 PM

For editors take a look at:
Sublime edit 2
Emacs
Vi
Vim
Komodo edit

I use emacs and sublime for scripting. Sublime is free but there is also a paid version.

In Topic: Choice of programming language

12 September 2012 - 03:13 PM

+1 previous post. Perl was popular, it still is, for bioinformatics work but ...
There are too many ways to do the same thing, your code can look very different to another bit of code that does the same thing. Writing good perl isn't as easy as say ruby or python.

He should have had a look at this first:
http://en.wikipedia....nguages_by_type
:)

Learn one or two scripting languages and the same for compiled.  The more you know the better your code becomes, you start to think and write code differently ... Try functional ;)

I would +1 for keeping all langs in the same space.

Also where is homebrew, that dude is handy with perl.

In Topic: How to use available Bioperl data to build evolutionary software?

11 September 2012 - 12:00 PM

Don't bother with a gui until you have got a working algorithm.  I also wouldn't consider using perl/tk for a GUI, I would wrap it as a web service (consider looking at something like perl catalyst but much lighter weight, google sinatra for perl)

I don't use windows machines, it's all OS X and Linux.  I would strongly advise anyone doing bioinformatics work (or just those with a passing interest) getting a copy of Ubuntu (free, it's linux) and doing your magic there.

  1. BioForum
  2. → Viewing Profile: Posts: DELETEMYACCOUNTPLEASE
  3. Privacy Policy
Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.