Hi I was trying to amplify a 5kb fragment from genomic DNA using Phusion high fidelity PCR but I never got any success. my forward primer is CCCACGAAACTCAAAATGTGTTCAGATTGC and my reverse primer is CACGAGCCAAAGTCATGCCAAAGAC. When I calculated the tm using the Tm calculator from Finnzymes it showed me around 72 C for both. I did a 2 step PCR with 72C but was unsuccessful. Each time I get a very low molecular band of around 200bp. I extracted the DNA and again ran the PCR but it was a failure again. I did a gradient with tm 55 to 65 which gave the same result. I used new dNTPs and borrowed enzyme from a collegue and saw that I had the same result. All my parameters look fine like primer concentration etc. Any suggestions? Please HELP.
Find content
Not Telling
