Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account
  2. → Viewing Profile: Posts: nvramakanth

nvramakanth

Member Since 22 Jan 2013
Offline Last Active Feb 04 2013 05:54 AM
-----

Posts I've Made

In Topic: I have a 96 tandem array repeat clone but need half of them in new clone

04 February 2013 - 05:24 AM

Hi

Thanks for the reply...The 96binding site tandem is developed by  biobrick cloning and it took long time for us..Thanks however

Thelymitra...can you please elaborate it to more extent

My Plasmid sequence is RFP1-96 BS(ACATGAGGATCACCCATGTGT)96 times....can you please explain furhter so that i could design primers...Thanks

  1. BioForum
  2. → Viewing Profile: Posts: nvramakanth
  3. Privacy Policy
Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.