Indhu

hi
i have designed a set of primers for checking cloning in the plasmid pET28b. Though the primers are not expected to bring out any band with empty plasmid, it shows a band around 100bp which is also observed in the transformant plasmid. the primer sequences are:PET F- ATTCGGATCCACTAGTTATTG  PET R- AATTCCCCTCTAGACCCTTGA. can anyone pls refer any online tool to get the sequence of the amplicons on submitting the template and primers.  
Indhu

hi al,
i have to clone four shRNAs under pcDNA 3.1. the enzymes planned to be used were Bam HI, Xba I and Spe I. Since pcDNA 3.1 has two sites for speI, it was deceided to clone the inserts in pET 28b first and then transfer to pcDNA 3.1. there is absolutely no problem in cloning a single shRNA insert. but i am facing repeated problems in cloning multiple shRNA inserts.  the plan is that single shRNA is inserted into the vector using BamHI and Xba I. for inserting the second insert, the vector is cut with Bam HI & SpeI and the insert is cut with BamHI & XbaI and are ligated together. Since Xba I and SpeI have compatible end, they stick together on ligation, eradicating the restriction site. this pave way for the cloning of further inserts into the same vector containing the two shRNA inserts. I am quite clear with this, but i do not know where it is going wrong.
Please help with this.
Indhu