SarahLee8

Great, thank you for the link!

pcrman and phage434, thank you so much for all of this input.  I think I have a better grasp of the primer designing issue now.  I see why this step is the most essential (and complicated!)

vilperte, thank you for that website!  I tried it out and I think it's much easier to understand than the other primer designing programs out there.  It would be great to hear about the polymerase you're using and how it turns out.  

I just have one more question...I really do understand why the amplicons should be much shorter than what I have, but do you think it's impossible to get results with a larger amplicon?  I'm hesitant to abandon my current experimental design for larger amplicons, but if it will never work, I will move on.  

Thank you!!

Wow, thank you, this has been incredibly helpful.  I think I understand where I went wrong during primer design.  Instead of taking the reverse complement of the sequence, I would only take the complement?  Does this then have something to do with the strands not being complementary anymore after bisulfite treatment?

Thank you very much for your quick responses!  

I will definitely look at reducing the amount of input DNA.

My PCR conditions:

Step 1: 5 minutes, 94 C
Step 2: 45 seconds, 94 C
            45 seconds, Tm 50 C
            1.5 minutes, 72 C
Step 3: 10 minutes, 72 C
             4 C, end

I have 40 cycles for step 2.

It is interesting that the extension times should be lower.  I will consider that as well.

I am using a hot start Taq provided by Zymo (it is what they recommend to use with their kit).

I designed my primers manually because of some problems with the regions I am amplifying (it is a specific L1 retrotransposon in a highly repetitive region).  Basically the primers that programs such as MethPrimer were giving me were hybridizing in different places all over the genome.  I'll add my sequence and primers below, if you wouldn't mind taking a look at it.  This is our first experience with methylation studies in our lab, so I've been trying to piece together as much advice as I can get.  


gtaggaccctctgagccaggtgtgggatatagtctcgtggtgcgccgttttttaagccggtctgaaaagcgcaatattcgggtgggagtgacccgattttccaggtgcgtccgtcacccctttctttgactcggaaagggaactccctgaccccttgcacttgccgagtgaggcagtgcctcaccctgcttcagctcatgaactgtgcactgctcccactgtcctgcatctgctgtctggcactccctagtgagatgaacccggtacctcagatggaaaagcagaaatcacccgtcttctgcgtctctcacgctgggagctgtagactggagctgttcctattcagccatcttggctcctcctccagtgtagtttttatttgaagatatttccttttccacaacaggcctcaaagctctccaaatatccacttgctggttctgcaaaaagagtgtttcataactgctcaataaaaataaaggttcaactctgtgtgatgaatgcactcatcacaaacaagtttctcagaatgcttccacgtagttttaatgtgaaggtatttccttttccacaataggccccacactctgcaaatatccactaggtcattcttcaaaaaggatgtttcaaaactgctcaataaaaaaaaaggttcaactccgtgtgaggaatgtattcatcacaaagaagtttctctgaatgcttctgtgtagtttttatatgaagatatttccttttacacaatagggcacaaagggctcc

In bold: L1 promoter sequence
Underlined: Primer sequences
Rest of sequence is unique genomic sequence 5’ adjacent to L1 promoter

Amplicon size: 761 bps

L1 Primer
GTA GGA TTT TTT GAG TTA GGT GTG (TM: 51.9)

Genomic Primer
GGA GTT TTT TGT GTT TTA TTG TGT (TM: 50.9)

Again, I appreciate very much all of your input.

texasepigenetics-

Were you able to re-design good primers based on your colleague's guidelines?  It would be great to hear your tips!