Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

Labrock

Member Since 05 Sep 2012
Offline Last Active Sep 07 2012 03:45 AM
-----

Posts I've Made

In Topic: *** Human Insulin promoter sequence***

06 September 2012 - 02:30 AM

View Postpcrman, on 05 September 2012 - 09:26 AM, said:

Here you are. The sequence in [ ] is the first exon.
cacacggaagatgaggtccgagtggcctgctgaggacttgctgcttgtccccaggtccccaggtcatgccctccttctgccaccctggggagctgagggcctcagctggggctgctgtcctaaggcagggtgggaactaggcagccagcagggaggggacccctccctcactcccactctcccacccccaccaccttggcccatccatggcggcatcttgggccatccgggactggggacaggggtcctggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtcctggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtcctggggacaggggtctggggacaggggtctgaggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtccgggggacaggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacaggggtgtggggacaggggtcctggggacaggggtgtggggataggggtgtggggacaggggtgtggggacaggggtgtggggacaggggtctggggacagcagcgcaaagagccccgccctgcagcctccagctctcctggtctaatgtggaaagtggcccaggtgagggctttgctctcctggagacatttgcccccagctgtgagcagggacaggtctggccaccgggcccctggttaagactctaatgacccgctggtcctgaggaagaggtgctgacgaccaaggagatcttcccacagacccagcaccagggaaatggtccggaaattgcagcctcagcccccagccatctgccgacccccccaccccaggccctaatgggccaggcggcaggggttgagaggtaggggagatgggctctgagactataaagccagcgggggcccagcagccctc[agccctccaggacaggctgcatcagaagaggccatcaagc]

Thank you very much. Could you please tell me where/how you found it..accession number? Really appreciate your help. Thank you

Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.