Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

aazmaish

Member Since 16 Sep 2011
Offline Last Active Jul 24 2012 06:44 AM
-----

#127010 Designing primers for miRNA located on minus strand.

Posted pcrman on 12 January 2012 - 08:19 PM

You can use the reverse-complementary sequence to design cloning primers. Here it is
>reverse complement
TTACCAGCGGGGTGTGATATGACCTAAGGTCCCGAACTCCTTCGAGAATACTTGGCTTAC
TGGAAAGAAGGCGCATCATAGACACCACTTCATCAGGGTAGTGTGTCTATATGTGTTGCC
TTATTACCAGAAGCATAAAAGCAGCATTTAGACCTGGTCATAAAGCCCCTGAGATGATTA
GCCTTATAGTCAGCTTTTTTACTGTAGCCATGTGTAGCTAAGGCCCCCTCCCTTTTCCAG
ACACAGAAGACACAAACAAAGAACTTCAGATTTTAACACA

I assume you know that you have to incorporate restriction site to the 5' end of your PCR primers so that the imRNA can be cloned into an expression vector from 5' to 3' end.

Actually you don't even need to reverse complement your sequence, you can still use the original sequence to design primers and clone the miRNA in the right orientation by controlling which restriction site goes to which primer.


Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.