Hi all,
I've been looking for the rate of blood flow in the human peritoneum in order to obtain a range of physiological shear stress values, for a set of protein-ligand interaction studies I have to do later on in my project (this is to do with ovarian cancer cells binding with mesothelial cells in the peritoneum).
However, I've been finding conflicting and confusing information in papers, and the vast majority are to do with peritoneal dialysis.
The figures I've seen most often are around 60-100 ml/min, but I've seen different rates based on clearance of different molecules.
Could someone tell me more about this, and provide me with a physiological range of shear stresses experienced in the peritoneum due to blood flow and/or lymph flow? Either of the figures (dynes/cm2 shear stress, or ml/min blood flow rate) I would appreciate references to accepted studies about this too.
Thanks a lot,
--
Shashwati Kala
- BioForum
- → Viewing Profile: Topics: shashwati
Community Stats
- Group Members
- Active Posts 4
- Profile Views 625
- Member Title member
- Age Age Unknown
- Birthday Birthday Unknown
-
Gender
Not Telling
Contact Information
0
Neutral
User Tools
Friends
shashwati hasn't added any friends yet.
Topics I've Started
Peritoneal Flow Rate and Shear Stress
29 November 2012 - 09:19 PM
Comparison of methods to evaluate ligand binding and glycan identification
29 November 2012 - 08:41 PM
Hi all,
I am a new research PG student at the University of Hong Kong, and have just begun my research project, which is investigating Lewis antigens in ovarian cancer.
The project hasn't yet attained a concrete direction yet, but part of it will involve evaluating the binding between Lewis antigens found on the surface of ovarian cancer cells and selectins. However, I am tasked with evaluating three different methods of doing this, none of which I am particularly familiar with-
1. Parallel-plate flow chamber
2. Biacore
3. Microfluidic chip
In particular, I am unable to find comparisons of these methods, that would tell me what their advantages and disadvantages are, compared to each other. Most things I find describe only one method, and are rather (understandably) biased towards it, as that is the angle of the paper.
Could anyone here describe these methods to me in simpler word than are generally used in scientific papers, and/or refer me to some useful reading resources regarding these, and give me some insight as to how these methods compare for the purposes described?
Secondly, I have also been asked to recommend a method to identify the glycans on the Lewis antigens I will be working with, and my supervisor prefers IP and mass spec. Could someone inform me of the options in this case and the merits of the methods?
(Additionally - some simple reading about Lewis antigens, and selectins in the peritoneum would be highly appreciated too.)
Thanks a lot,
--
Shashwati Kala
I am a new research PG student at the University of Hong Kong, and have just begun my research project, which is investigating Lewis antigens in ovarian cancer.
The project hasn't yet attained a concrete direction yet, but part of it will involve evaluating the binding between Lewis antigens found on the surface of ovarian cancer cells and selectins. However, I am tasked with evaluating three different methods of doing this, none of which I am particularly familiar with-
1. Parallel-plate flow chamber
2. Biacore
3. Microfluidic chip
In particular, I am unable to find comparisons of these methods, that would tell me what their advantages and disadvantages are, compared to each other. Most things I find describe only one method, and are rather (understandably) biased towards it, as that is the angle of the paper.
Could anyone here describe these methods to me in simpler word than are generally used in scientific papers, and/or refer me to some useful reading resources regarding these, and give me some insight as to how these methods compare for the purposes described?
Secondly, I have also been asked to recommend a method to identify the glycans on the Lewis antigens I will be working with, and my supervisor prefers IP and mass spec. Could someone inform me of the options in this case and the merits of the methods?
(Additionally - some simple reading about Lewis antigens, and selectins in the peritoneum would be highly appreciated too.)
Thanks a lot,
--
Shashwati Kala
Substituting miRNA with ODNs for testing efficiency of dendrimers...?
22 May 2012 - 01:51 PM
Hi all,
I'm looking for some help with justifying an experiment that I've already done that involves using PAMAM dendrimers to deliver small RNAs into SKOV-3 cells.
It should've been a very straightforward set of experiments; use RT-PCR to first establish the relative levels of expression of a microRNA important in ovarian cancer between adherent SKOV-3 cells and SkSp cells grown as free-floating spheroids. The SKOV-3 monolayer cells' microRNA levels would be the control. After establishing this, the dendrimers could be used to deliver microRNA inhibitors or mimics to re-establish normal levels of microRNA expression.
The crux of my research project was to demonstrate that dendrimers were efficient devlivery vehicles for small RNAs and to contrast their efficiencies at different concentrations, etc.
However, the RT-PCR turned out to be a real challenge, and by the time I was able to figure out a protocol that gave me consistent results with untreated cells it was really late in the day to start ordering mimics and inhibitors and things.
What I did instead was to try and get creative with what I had. A labmate had, for some reason, ordered various oligodeoxynucleotide primers of the same sequence as various microRNA, with sequences obtained from mirBase. For instance, the hsa-let-7a-5p primer had the sequence of: tgaggtagtaggttgtatagtt, which is basically the sequence of the mature miRNA but with deoxynucleotides. I refer to them as "sense-ODNs".
I reasoned that such primers would be tantamount to the same mature miRNA sequence if being detected by RT primers (which would also be ODNs). Hence, if I were to transfect these primers with sequences equivalent to mature miRNAs, and then perform RT-PCR with primers to detect the sequence of the mature miRNA, the additional sense-ODNs that were transfected should also be detected.
I used let-7a, 7b and 7c, which are downregulated in SkSp cells, and found that the levels of nucleic acids with sequences equivalent to the mature miRNA sequence detected by RT-PCR were found to have inceased when compared to the controls.
Now, I do realise that this is fundamentally not the same as actually affecting the function of the miRNA and affect changes in the progress of the cancers. The downstream effects of re-establishing miRNA levels would definitely not be seen. However, as I have mentioned, the thrust of the project is meant to be to highlight the ability of dendrimers as delivery vehicles; hence, I reason that the above experiment would be sufficient as a proof-of-principle that the dendrimers would be able to deliver the material for miRNA transfections successfully, especially given that many of the inhibitors and mimics are single-stranded, as are these sense-ODNs. I, like most, have had no problems transfecting ds-siRNA into cells.
What I would like your opinion on is the status of this "creative" substitution as a proof-of-principle about potential future uses for dendrimers with miRNA, and how I could best go about justifying this. I know there are differences with how dendrimers bind to single-stranded and double-stranded molecules which could play a part in the transfections, for instance.
I would also deeply appreciate any references to research that could be provided, since I have found only two papers that use miRNA and dendrimers.
Thanks, and I look forward to your critiques.
--
Shashwati Kala
I'm looking for some help with justifying an experiment that I've already done that involves using PAMAM dendrimers to deliver small RNAs into SKOV-3 cells.
It should've been a very straightforward set of experiments; use RT-PCR to first establish the relative levels of expression of a microRNA important in ovarian cancer between adherent SKOV-3 cells and SkSp cells grown as free-floating spheroids. The SKOV-3 monolayer cells' microRNA levels would be the control. After establishing this, the dendrimers could be used to deliver microRNA inhibitors or mimics to re-establish normal levels of microRNA expression.
The crux of my research project was to demonstrate that dendrimers were efficient devlivery vehicles for small RNAs and to contrast their efficiencies at different concentrations, etc.
However, the RT-PCR turned out to be a real challenge, and by the time I was able to figure out a protocol that gave me consistent results with untreated cells it was really late in the day to start ordering mimics and inhibitors and things.
What I did instead was to try and get creative with what I had. A labmate had, for some reason, ordered various oligodeoxynucleotide primers of the same sequence as various microRNA, with sequences obtained from mirBase. For instance, the hsa-let-7a-5p primer had the sequence of: tgaggtagtaggttgtatagtt, which is basically the sequence of the mature miRNA but with deoxynucleotides. I refer to them as "sense-ODNs".
I reasoned that such primers would be tantamount to the same mature miRNA sequence if being detected by RT primers (which would also be ODNs). Hence, if I were to transfect these primers with sequences equivalent to mature miRNAs, and then perform RT-PCR with primers to detect the sequence of the mature miRNA, the additional sense-ODNs that were transfected should also be detected.
I used let-7a, 7b and 7c, which are downregulated in SkSp cells, and found that the levels of nucleic acids with sequences equivalent to the mature miRNA sequence detected by RT-PCR were found to have inceased when compared to the controls.
Now, I do realise that this is fundamentally not the same as actually affecting the function of the miRNA and affect changes in the progress of the cancers. The downstream effects of re-establishing miRNA levels would definitely not be seen. However, as I have mentioned, the thrust of the project is meant to be to highlight the ability of dendrimers as delivery vehicles; hence, I reason that the above experiment would be sufficient as a proof-of-principle that the dendrimers would be able to deliver the material for miRNA transfections successfully, especially given that many of the inhibitors and mimics are single-stranded, as are these sense-ODNs. I, like most, have had no problems transfecting ds-siRNA into cells.
What I would like your opinion on is the status of this "creative" substitution as a proof-of-principle about potential future uses for dendrimers with miRNA, and how I could best go about justifying this. I know there are differences with how dendrimers bind to single-stranded and double-stranded molecules which could play a part in the transfections, for instance.
I would also deeply appreciate any references to research that could be provided, since I have found only two papers that use miRNA and dendrimers.
Thanks, and I look forward to your critiques.
--
Shashwati Kala
- BioForum
- → Viewing Profile: Topics: shashwati
- Privacy Policy





Find content