Find content
Male
I'm working on Saccharmoyces cerevisiae for the first time and am intending to co-express 2 proteins from one plasmid. I have initially thought I can simply clone the genes serially and they will express under the same promoter, like in E. coli. Would this work in S. cerevisiae? I'm asking because I've read many papers and they all use pESC vector such that each gene is under the control of their own promoter. Is this essential?
#153459 Are two promoters needed for co-expressing 2 proteins from the same plasmid in S
Posted
on 08 April 2013 - 08:56 PM
#88985 Adding Restriction Site to DNA
Posted
on 07 October 2010 - 07:49 AM
If you want to amplify your DNA, you need a pair of forward and reverse primers. To add restriction sites, your primers will be designed to contain your restriction sites, followed by a short stretch of your DNA sequence. For your case using BamHI (cleavage site GGATCC) and PvuI (CGATCG),
CTAGCGGGATCCATGGCTACGTGG
____________ATGGCTACGTGGCTGGGCATCCGAT...............................CGTACGTGGACTATTGA
____________TACCGATGCACCGACCCGTAGGCTA...............................GCATGCACCTGATAACA
____________________________________________________________________GCATGCACCTGATAACACGATCGTGCATG
Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.
Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.
CTAGCGGGATCCATGGCTACGTGG
____________ATGGCTACGTGGCTGGGCATCCGAT...............................CGTACGTGGACTATTGA
____________TACCGATGCACCGACCCGTAGGCTA...............................GCATGCACCTGATAACA
____________________________________________________________________GCATGCACCTGATAACACGATCGTGCATG
Top row is a possible forward primer design (5'->3'), second row is the sense DNA strand (for example)(5'->3'), third row is the anti-sense DNA strand (3'->5'), and last row is a possible reverse primer design (3'->5'). The forward primer has BamHI site (underlined) followed by a short stretch of the DNA of interest (sense). The reverse primer has PvuI site and a short stretch of the DNA of interest (anti-sense). The PCR product will then have both restriction sites in it. You can then digest the DNA fragment with the restriction enzymes. The extra (random) bases before the restriction sites are for efficient digestion because some restriction enzymes cannot digest DNA too near to the ends.
Is this a tutorial question or a practical application? I'm not sure if the DNA sequence you provided is the sequence you want to amplify 'cos for such a short sequence, you might as well synthesise the DNA fragment with the restriction sites included instead of PCR. If this is a tutorial question, replace the DNA sequence in the example here with your sequence to get your answer, provided I understood your question correctly.
#87967 Rnase A for plasmid miniprep
Posted
on 25 September 2010 - 11:28 PM
What is the RNase for actually? Is it really essential? The guys who last used the miniprep kit in my new lab left the P1 in the box instead of storing it in the fridge. They last used it a year ago! I wonder if the RNase is dead. I used it anyway and got my plasmid but I wonder if there will be any future problem.
