pDNA

Dear people,

  i'm currently trying to generate a sigma-factor library using pHSG576-derivative (SC101ori, low copy) as backbone. I'm trying to get a library size of 10E5-10E6 ...but i'm far away from that currently. I have the feeling that the backbone is one of the major problems.

Therefore, i would like to ask if anybody has suggestions for a low copy plasmid backbone that has been used excessively for library generation?
I was thinking about pBELOBac11? Any other suggestions?

In addition, does anyone has a good references (book, journal articles) that deal with library generation in E. coli?

I very much appreciate your help!

Many thanks in advance!

Best regards,
p

I have problems detecting T7 RNA polymerase in e.g. samples from E. coli BL21(DE3) after induction.

I use a primery (mouse monoclonal T7 RNA Polymerase antibody [IgG1]) and secondary (Goat Anti-Mouse IgG [H+L] AP Conjugate) from Novagen for the detection of the T7 RNA polymerase. Unfortunately so far without success!

I tried dection with BCIP and CDP-star already ...but was not able to get any real signal yet. My positive control is stained but i'm not able to detect anything in my samples. My samples have to contain T7 RNA polymerase since i can detect a load of my recombinant protein in my samples.
I do lyse my cells and then fractionate into soluble and insoluble fraction. I normally load both fractions on a gel. In the original protocol they do the use the whole cell extract. Can this make a difference?

Has anyone an idea what could be the reason for my misery?
Are there alternatives available to detect T7 RNA polymerase?

Best regards,
p

Dear people,

   i need someone withe expertise in FLP-FRT recombination. I obtained a strain from the Keio collection and actually learned by sequencing the the strain carries a mutation in one of the FRT sites changing the sequence to GAAGTTCCTATTCTCTAGGAAGTGTAGGAACTTC (instead of GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC).

Does anyone konw if this will dramatically alter the recombination efficiency? ...i need to get rid of the resistance ...if this is not possible i'm in trouble!

Many thanks in advance!

Best regards,
p

Dear people,

    can somebody recommend a good proof-reading enzyme that can be used for the amplification from genomic DNA (E. coli). We have done several modifications and we want to confirm them.
We have tried two Taq polymerase(HybriPol, a rather fast enzyme and recombinant Taq from Fermentas), Phusion polymerase and KOD. Phusion, KOD and recombinant Taq give use most of the time no product at all. The fast Hybripol gives us product but a lot of unspecific bands as well ...therefore not suitable for sequencing.

Maybe someone of you can suggest a good enzyme that has a good performance when using gDNA as a template.
I'm also open for general suggestions when using genomic DNA as a template. I'm really loosing nervs at the moment and any advice is welcome!

Many thanks in advance!

Best regards,
p

Dear people,

    i'm kind of desperate ...i'm looking for a plasmid that has the tetracycline repressor (tetR) and a tet promoter (or pLtet-O) on its backbone. I'm looking for plasmids that do contain the tetR with a own promoter (not transcriptionally fused to bla or something else).

Maybe someone of you has any suggestions? ...i do not necessarily need a physical plasmid ...i'm only looking for a valid expression unit of the tetR with a promoter (since i'm planning to do a synthetic construct) ...that has been reported to functional.

Many thanks in advance!

Best regards,
p