Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

- - - - -

Using BLAST to check primers


  • Please log in to reply
17 replies to this topic

#1 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 11 August 2009 - 08:37 AM

Hello all, I searched and couldn't find a topic on this (even though I'm sure it's there somewhere) but I have a question regarding BLAST and checking primers. So I am cloning a specific gene out of some gDNA from M. Tuberculosis and have designed some primers to do this. I was told I had to BLAST my primers against the genome to see if my primers were specific to the region I want to amplify. Well, I didn't do that at first, and sure enough my PCR turned out like garbage. I've tried figuring it out myself but have had no luck, so if anyone can help tell me how to use BLAST to check my primers, I would be more than grateful. I've attempted to use the primer design tool on BLAST but haven't had much luck with that either, plus, the primers I'm designed have to have bases complementary to the overhangs in my eK/LIC vector I'm placing the DNA in. Thanks!

#2 macroman

macroman

    member

  • Active Members
  • Pip
  • 15 posts
0
Neutral

Posted 11 August 2009 - 09:24 AM

Just load your primers and select appropriate stain in the following link.

http://insilico.ehu....o=Mycobacterium

Hope this helps....

#3 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 11 August 2009 - 11:55 AM

Thanks, that helped a bit, although I have finally figured out how to use BLAST properly. The primers I used got TONS of hits... whoops. I am confused on the "score" number though and if it is more important or just as important as the identity number. For example, a new primer I designed got a 90% identity and a score of like 74, however, there were other sequences which had 100% identity but only a score of 28. Is there a rule of thumb of what or what not to accept? Thanks again.

Edited by NYYFan, 11 August 2009 - 11:56 AM.


#4 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 11 August 2009 - 04:32 PM

You're missing a piece of information -- how many bases comprised the 70% ID, and over how many bases did it match at 100%?

Also, are you using Primer BLAST?

#5 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 11 August 2009 - 06:51 PM

View PostHomeBrew, on Aug 11 2009, 05:32 PM, said:

You're missing a piece of information -- how many bases comprised the 70% ID, and over how many bases did it match at 100%?

Also, are you using Primer BLAST?

I've tried the primer blast but the problem is my primers have to have a certain overhang because of the vector I'm using. I have to have primers at each end of the gene for this. When I use primer blast they give me primers at various locations throughout the gene. I've never done primer design before and was kind of thrown into this on my own and am trying to learn as much as I can without having to ask for serious help from the postdocs around the other labs in the building. I'm getting different results now then what I was getting earlier... this is frustrating. So what I'm doing is going to nucleotide blast --> Putting my primer sequence in the "Enter Query Sequence" box and then putting in my organism in the "Choose Search Set" area. I then BLAST and get my "hits." I just got over 4000 hits for my primer, my target gene was first with a score of 42.1 (about 21/21 matches) and 100% identity, all the other matches were mostly 100% identity's but had scores of about 20 (matches of 13/13 or less). Less of my primer sequence matched them. Am I going about this the right way? It seems like I'm making this harder than it really is haha. Thanks for everything so far.

Edited by NYYFan, 11 August 2009 - 06:52 PM.


#6 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 12 August 2009 - 04:17 AM

First off, it's good that your best match is what you expect, and that the match is 100% over the full length of the primer.  I understand that you need to add restriction sites to the 5' end of the primers, but they won't participate in the amplification initially, so you should remove them from the sequence you're BLASTing as they'll just confuse the results.  Use just the bases that match your target sequence.  Secondly, even if you have a "good" match somewhere else in your genome, if it's off at the 3' end of the primer, it won't matter, because the primer will fail to amplify at this target location.

This second point is why I don't bother to check my primers by BLAST (BTW, I've designed and used thousands of primers).  The value of BLASTing your primers is diminished by the fact that even if BLASTing shows a good match -- say 20 of 21 bases -- if the 3' base is wrong, the primer will fail.  So there is a disconnect between a degree of identity match and what will really work in PCR, which really reduces the usefulness of performing this step.

The proof is in the pudding, as they say -- the way I find out if my primers are any good is to use them.

You said your PCR "turned out like garbage".  No amount of BLASTing is going to fix that, so let's back up a bit.  How did you design your primers?  What were your PCR conditions?  How much template did you use?  Define "turned out like garbage".

#7 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 12 August 2009 - 06:12 AM

View PostHomeBrew, on Aug 12 2009, 04:17 AM, said:

First off, it's good that your best match is what you expect, and that the match is 100% over the full length of the primer.  I understand that you need to add restriction sites to the 5' end of the primers, but they won't participate in the amplification initially, so you should remove them from the sequence you're BLASTing as they'll just confuse the results.  Use just the bases that match your target sequence.  Secondly, even if you have a "good" match somewhere else in your genome, if it's off at the 3' end of the primer, it won't matter, because the primer will fail to amplify at this target location.

This second point is why I don't bother to check my primers by BLAST (BTW, I've designed and used thousands of primers).  The value of BLASTing your primers is diminished by the fact that even if BLASTing shows a good match -- say 20 of 21 bases -- if the 3' base is wrong, the primer will fail.  So there is a disconnect between a degree of identity match and what will really work in PCR, which really reduces the usefulness of performing this step.

The proof is in the pudding, as they say -- the way I find out if my primers are any good is to use them.

You said your PCR "turned out like garbage".  No amount of BLASTing is going to fix that, so let's back up a bit.  How did you design your primers?  What were your PCR conditions?  How much template did you use?  Define "turned out like garbage".

First off, thank you very much for the reply!

When I say my PCR turned out like garbage, basically I was amplifying the wrong region, I was getting a strong band around the 650 bases region whereas my desired product should be ~2.5 kb.  The vector I'm using is a pET 46 eK/LIC vector, there are no restrcition enzymes involved in this vector, it is an open vector which contains overhangs in which my primers must have complementary base pairs too. The first 12 or so bases of both the forward and reverse primers are already "pre-chosen" if you will. So my forward primer sequence would have to start GACGACGACAAGATG..... and then into my gene. The reverse primer has to end with ...GGCCCGAAGAGGAG with having the base pairs of the gene at the beginning of that sequence. Initially I just took both of those sequences and went about 10 more base pairs into the gene and tried those primers, those failed as I previously described. I'm cloning out of the gDNA of the H37Rv strand of M. Tuberculosis, which is probably making this more difficult than if I were cloning out of a plasmid or something. If this turns out to be a problem with the vector I'm using, I may have to use another vector.  My PCR conditions were as follows:
1) initial denat. for 10 mins.
2) denat. for 10 s
3) annealing: 15 s at 62, 65, and 68 degrees (3 different rxns)
4) extention at 72 for 1 min. 30 s
5) repeat 2-4 30x
6) final extension for 10 mins at 72
7) hold at 4

I used ~100 ng of template DNA and also 5% DMSO
Thanks again!

#8 eldon

eldon

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 63 posts
0
Neutral

Posted 12 August 2009 - 07:01 AM

GACGACGACAAGATG looks horrible and unnecessary to me. 15 non-specific GC rich nucleotides is going to cause problems in a 25mer. you might want to design a 40mer by adding another 15 nt's to the 3' end of the primers...they should anneal more efficiently and the non-specific 5' end shouldn't anneal to your target in the first few rounds of your PCR.

what PCR mix are you using? plain old taq or a proofreading taq? a proofreader is ideal...something like Pfu turbo.

10 min. initial denature seems ok...might be a little long...i use 3-5 min.
try 30 sec. 94C denature.

try 20-30 sec. annealing but start at the high temp and proceed to the lower temp..touchdown pcr. starting lower will contribute to non-specific amplification. 68C is high and at this temp your taq is working just as well as at 72C.

depending on your taq...amplification time should generally be 1 min/kb. so you should be trying a 2 min. 30 sec amplification.

amount of starting material will dictate the number of cycles...35 seems a good start..but without a proofreader, extending the cycles may cause over-amplification of your product and increased error incorporation at 2.5 kb.

you can hold at 12-16C...it's better for your machine, especially if you're holding overnight.

the best PCR cloning vector i have ever used is called pJET (fermentas). the ligation is blunt but all your colonies have insert. your fragment when ligated into the vector disrupts a gene that when expressed in bacteria kills the cells. re-ligated vector prevents the cells from growing. the only chance for a false positive might come from cloning unpurified PCR product.

Edited by eldon, 12 August 2009 - 07:02 AM.


#9 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 12 August 2009 - 07:20 AM

View Posteldon, on Aug 12 2009, 07:01 AM, said:

GACGACGACAAGATG looks horrible and unnecessary to me. 15 non-specific GC rich nucleotides is going to cause problems in a 25mer. you might want to design a 40mer by adding another 15 nt's to the 3' end of the primers...they should anneal more efficiently and the non-specific 5' end shouldn't anneal to your target in the first few rounds of your PCR.

what PCR mix are you using? plain old taq or a proofreading taq? a proofreader is ideal...something like Pfu turbo.

10 min. initial denature seems ok...might be a little long...i use 3-5 min.
try 30 sec. 94C denature.

try 20-30 sec. annealing but start at the high temp and proceed to the lower temp..touchdown pcr. starting lower will contribute to non-specific amplification. 68C is high and at this temp your taq is working just as well as at 72C.

depending on your taq...amplification time should generally be 1 min/kb. so you should be trying a 2 min. 30 sec amplification.

amount of starting material will dictate the number of cycles...35 seems a good start..but without a proofreader, extending the cycles may cause over-amplification of your product and increased error incorporation at 2.5 kb.

you can hold at 12-16C...it's better for your machine, especially if you're holding overnight.

the best PCR cloning vector i have ever used is called pJET (fermentas). the ligation is blunt but all your colonies have insert. your fragment when ligated into the vector disrupts a gene that when expressed in bacteria kills the cells. re-ligated vector prevents the cells from growing. the only chance for a false positive might come from cloning unpurified PCR product.

The GACGACGACAAG sequence is to code for an enterokinase site to where I can cleave off the N-terminal his-tag after protein purification. I've tried adding quite a few more nucleotides to the ends of the primers, but I start approaching a Tm over 80 before too long (at about 32 b.p.), I guess b/c it's so GC rich. I am using the Phusion High Fidelity PCR Mater-Mix kit by Finnzymes for my rxns. and am basically following their protocol for the PCR conditions, I'm not exactly which kind of Taq polymerase it uses. I usually take my rxns. out within 30 mintues after they're done, but if I ever leave overnight I will definitely keep the higher temperature in mind.

I have come up with this for the primers:
Forward primer: ACGACGACAAGATGACAGACACGACGTTGC
Reverse primer: GTCTGCCCGTTAATTGGCCCGAAGAGGAG

The bolded parts are the parts I must have for the vector overhangs, the non-bolded parts are from the gene itself.

Both have a Tm of ~79 C, but I'm still not so sure they will work too great for my strain. Maybe I'll just bite the bullet and order and try them.

Thanks!

Edited by NYYFan, 12 August 2009 - 07:22 AM.


#10 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 12 August 2009 - 09:48 AM

View PostNYYFan, on Aug 12 2009, 10:12 AM, said:

Initially I just took both of those sequences and went about 10 more base pairs into the gene and tried those primers, those failed as I previously described.

This is likely your problem -- you in essence designed a 10-bp primer, and I'm not suprised that the PCR looked horrible.  What you need to do is design your primers first (I usually use 24 bp, but anything from 20 bp - 30 bp usually works well), and then add the 5' sequences you need on to them before ordering them.

Look at it this way.  I don't use the vector system you describe, but I almost always add 10 bases to the 5' end of my primers (a six-bp restriction site and 4 irrelevant 5' bases to allow the enzyme to cut efficiently).  These 10 bases are added *after* I've selected my 24-bp primers on the basis of Tm, secondary structure considerations, uniqueness of sequence, position on template, etc. -- right before I order them, I tack the ten 5' bases on.

How are you selecting your primers?  If you're eyeballing them, I suggest strongly that you instead use a primer design program (I use Primer3).  Design your primers without regard for the 5' sequences you need.  When you have a pair that are a good match as to Tm etc., and prime where you need them to, and look good in BLAST (if you're going to do that), *then* add your 5' bases required by your vector and order them.

I ran the primer sequences you provided above without the 5' extensions.  Here's what I got:


Primer pair 1
Sequence (5'->3') Length Tm GC%
Forward primer ATGACAGACACGACGTTGC 19 52.89 52.63%
Reverse primer GTCTGCCCGTTAATT 15 41.25 46.67%

Products on target templates

--------------------------------------------------------------------------------

>NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome

product length = 5631
Features associated with this product:
   PPE family protein

   PPE family protein

Forward primer  1        ATGACAGACACGACGTTGC  19
Template        2163152  ...C.G.G.C.........  2163170

Reverse primer  1        GTCTGCCCGTTAATT  15
Template        2168782  CA.AC.........A  2168768


product length = 2034
Features associated with this product:
   long-chain-fatty-acid--[acyl-carrier-protein] ligase

   acyl-CoA dehydrogenase

Forward primer  1        ATGACAGACACGACGTTGC  19
Template        1509566  TG.G.G...G........A  1509584

Forward primer  1        ATGACAGACACGACGTTGC  19
Template        1511599  CCCGTT.........C...  1511581


product length = 5291
Features associated with this product:
   hypothetical protein

   isopentenyl-diphosphate delta-isomerase

Reverse primer  1        GTCTGCCCGTTAATT  15
Template        1976270  CCA.T..........  1976256

Reverse primer  1        GTCTGCCCGTTAATT  15
Template        1970980  ACG..G.........  1970994


So, the Tm's of your forward and reverse primers are 52.89 and 41.25, respectively -- too low.  Also, your primer sequences don't match anything on the Mycobacterium tuberculosis H37Rv genome completely.  This is also a problem...

#11 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 12 August 2009 - 10:51 AM

View PostHomeBrew, on Aug 12 2009, 09:48 AM, said:

View PostNYYFan, on Aug 12 2009, 10:12 AM, said:

Initially I just took both of those sequences and went about 10 more base pairs into the gene and tried those primers, those failed as I previously described.

This is likely your problem -- you in essence designed a 10-bp primer, and I'm not suprised that the PCR looked horrible.  What you need to do is design your primers first (I usually use 24 bp, but anything from 20 bp - 30 bp usually works well), and then add the 5' sequences you need on to them before ordering them.

Look at it this way.  I don't use the vector system you describe, but I almost always add 10 bases to the 5' end of my primers (a six-bp restriction site and 4 irrelevant 5' bases to allow the enzyme to cut efficiently).  These 10 bases are added *after* I've selected my 24-bp primers on the basis of Tm, secondary structure considerations, uniqueness of sequence, position on template, etc. -- right before I order them, I tack the ten 5' bases on.

How are you selecting your primers?  If you're eyeballing them, I suggest strongly that you instead use a primer design program (I use Primer3).  Design your primers without regard for the 5' sequences you need.  When you have a pair that are a good match as to Tm etc., and prime where you need them to, and look good in BLAST (if you're going to do that), *then* add your 5' bases required by your vector and order them.

Ahhhh, well that makes things different for me. So when I do my PCR should I make my annealing temperatures close to those of the primer Tm without the added 5' sequences? For example, if my primers without the added 5' sequence have a Tm of 65 and the primers with the added 5' sequence have a Tm of 82, I would use a temperature closer to 65 for my annealing temps? I have been designing my primers by eye, I tried using the Primer BLAST, which I believe is powered by Primer3, and I would get primers which ended up all throughout the gene rather than on the ends of the genes where I need them. Maybe I'll give it another go then. Thanks again for your patience and answers! It's much appreciated.

The gene I'm trying to clone out BTW is gene encoding for gyrA, which are base pairs 7302-9818 of the H37Rv genome. Apparently I have some more work to do here! Something that seems so simple and I'm completely goofing it up!

Edited by NYYFan, 12 August 2009 - 10:53 AM.


#12 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 12 August 2009 - 12:53 PM

View PostNYYFan, on Aug 12 2009, 02:51 PM, said:

Ahhhh, well that makes things different for me. So when I do my PCR should I make my annealing temperatures close to those of the primer Tm without the added 5' sequences? For example, if my primers without the added 5' sequence have a Tm of 65 and the primers with the added 5' sequence have a Tm of 82, I would use a temperature closer to 65 for my annealing temps?

Correct.  Assuming you must begin your forward primer at base 1 (the "A" of the ATG start codon) and end it at base 2517 (the final "A" of the TAA stop codon), and using the sequence found here, about the best you can do is something like:

OLIGO			start  len	  tm	 gc%   any	3' seq 
LEFT PRIMER		  1   20   62.18   55.00  5.00  3.00 atgacagacacgacgttgcc
RIGHT PRIMER	  2517   20   61.02   50.00  4.00  1.00 ttaattgcccgtctggtctg

Product Size: 2517

	1 atgacagacacgacgttgccgcctgacgactcgctcgaccggatcgaaccggttgacatc
	  >>>>>>>>>>>>>>>>>>>>										
.
.
.																  

 2461 gaaagtggcgacgataatgccgtggacgccaacggcgcagaccagacgggcaattaa
										   <<<<<<<<<<<<<<<<<<<<

View PostNYYFan, on Aug 12 2009, 02:51 PM, said:

I have been designing my primers by eye, I tried using the Primer BLAST, which I believe is powered by Primer3, and I would get primers which ended up all throughout the gene rather than on the ends of the genes where I need them. Maybe I'll give it another go then.

The easiest way I've found to pick primers when you must have them begin at particular bases is to use the Primer3Plus interface to Primer3 (see an example here).  You paste your sequence in the box, select "Cloning" from the Task box in the upper left, and identify where your primers must begin using "{" to mark the position where the forward primer must start and "}" for where the reverse primer must start (without the quotes, of course -- e.g. the sequence in the box for this example would look like {atgaca...aattaa}), set your parameters in the General Settings tab -- for example, I usually set minimum primer length to 20, optimal to 24, and max to 30, but you can leave these at the defaults if you like), and click on the Pick Primers button.

The program will perhaps complain about minor defects in the primer (it yells about the 3' stability of the forward primer above, for example), but since you must have the primers start at a particular base your choices are minimal, and (according to Primer3) this is the best set of primers possible, defects and all (I've never had a problem with some of the errors Primer3 yells about...).

View PostNYYFan, on Aug 12 2009, 02:51 PM, said:

Thanks again for your patience and answers! It's much appreciated.

No problem.  Someone showed me how to do it long ago, and I'm paying them back -- even if I'm a Red Sox fan and can see Fenway out my lab window...:P.

You design your PCR program around the Tm's shown above.  Don't forget to append the sequences you need (in 5'->3' direction) to the primers before you order them!

#13 HomeBrew

HomeBrew

    Veteran

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 927 posts
14
Good

Posted 12 August 2009 - 07:38 PM

BTW, when you BLAST these primers against Mycobacterium tuberculosis H37Rv, you get:

Primer pair 1
				Sequence (5'->3')	   Length  Tm	  GC%
Forward primer	ATGACAGACACGACGTTGCC	20	55.26	55.00%
Reverse primer	TTAATTGCCCGTCTGGTCTG	20	52.10	50.00%


>NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome

product length = 2517
Features associated with this product:
   DNA gyrase subunit A

Forward primer  1	 ATGACAGACACGACGTTGCC  20
Template		7302  ....................  7321

Reverse primer  1	 TTAATTGCCCGTCTGGTCTG  20
Template		9818  ....................  9799


product length = 2253
Features associated with this product:
   hydrolase

   hypothetical protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3109070  CG...G.C.G.C........  3109089

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3111322  GACC...G..A........T  3111303


product length = 1528
Features associated with this product:
   3-ketoacyl-(acyl-carrier-protein) reductase

   acetyl-CoA acetyltransferase

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		290690  CA....CGA.T.........  290709

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		292217  GCG.C.CG...C........  292198


product length = 5800
Features associated with this product:
   putative acetyl-CoA carboxylase biotin carboxyl carrier p...

   anti-sigma factor

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3597669  .GC.GCAC........C...  3597688

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3603468  ACC.GC.....GT.......  3603449


product length = 5019
Features associated with this product:
   hypothetical protein

   methanol dehydrogenase transcriptional regulatory protein...

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3531859  .CAG..AC........G...  3531878

Forward primer  1		ATGACAG-ACACGACGTTGCC  20
Template		3536877  -.CT.G.T...A.........  3536858


product length = 4627
Features associated with this product:
   hypothetical protein

   hypothetical protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3114295  TCAT..AT........C...  3114314

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3118921  GGGTAGC....G........  3118902


product length = 3005
Features associated with this product:
   acyltransferase

   transcriptional regulatory protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		1402468  GGCG.GCC........C...  1402487

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		1405472  ..C..G..GGT........G  1405453


product length = 1630
Features associated with this product:
   dihydrolipoamide dehydrogenase

   hypothetical protein

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		553845  TG.T.G.C........G...  553864

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		555474  GCC.GTTC........C...  555455


product length = 4952
Features associated with this product:
   nickel-transport integral membrane protein

   short chain dehydrogenase

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3172679  G.G..C...GAC........  3172660

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3167728  GCC.......TG........  3167747


product length = 6002
Features associated with this product:
   mannosyltransferase

   pterin-4-alpha-carbinolamine dehydratase

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		1292184  CGTCG........GC.G...  1292165

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		1286183  GCCTGG...G.........A  1286202


product length = 893
Features associated with this product:
   integral membrane protein

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		682781  .....C.GTGC........A  682762

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		681889  A.C...T.GT........A.  681908


product length = 5280
Features associated with this product:
   MerR family transcriptional regulator

   integral membrane protein

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3726125  AGCT..C...........A.  3726106

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3720846  AGGTG..G.T........A.  3720865


Note the different Tm calculation used by the Primer BLAST program...  I always anneal at about two degrees under the Primer3 Tm, and it's worked well for me....

#14 NYYFan

NYYFan

    member

  • Active Members
  • Pip
  • 12 posts
0
Neutral

Posted 13 August 2009 - 07:59 AM

View PostHomeBrew, on Aug 12 2009, 07:38 PM, said:

BTW, when you BLAST these primers against Mycobacterium tuberculosis H37Rv, you get:

Primer pair 1
				Sequence (5'->3')	   Length  Tm	  GC%
Forward primer	ATGACAGACACGACGTTGCC	20	55.26	55.00%
Reverse primer	TTAATTGCCCGTCTGGTCTG	20	52.10	50.00%


>NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome

product length = 2517
Features associated with this product:
   DNA gyrase subunit A

Forward primer  1	 ATGACAGACACGACGTTGCC  20
Template		7302  ....................  7321

Reverse primer  1	 TTAATTGCCCGTCTGGTCTG  20
Template		9818  ....................  9799


product length = 2253
Features associated with this product:
   hydrolase

   hypothetical protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3109070  CG...G.C.G.C........  3109089

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3111322  GACC...G..A........T  3111303


product length = 1528
Features associated with this product:
   3-ketoacyl-(acyl-carrier-protein) reductase

   acetyl-CoA acetyltransferase

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		290690  CA....CGA.T.........  290709

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		292217  GCG.C.CG...C........  292198


product length = 5800
Features associated with this product:
   putative acetyl-CoA carboxylase biotin carboxyl carrier p...

   anti-sigma factor

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3597669  .GC.GCAC........C...  3597688

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3603468  ACC.GC.....GT.......  3603449


product length = 5019
Features associated with this product:
   hypothetical protein

   methanol dehydrogenase transcriptional regulatory protein...

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3531859  .CAG..AC........G...  3531878

Forward primer  1		ATGACAG-ACACGACGTTGCC  20
Template		3536877  -.CT.G.T...A.........  3536858


product length = 4627
Features associated with this product:
   hypothetical protein

   hypothetical protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		3114295  TCAT..AT........C...  3114314

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3118921  GGGTAGC....G........  3118902


product length = 3005
Features associated with this product:
   acyltransferase

   transcriptional regulatory protein

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		1402468  GGCG.GCC........C...  1402487

Forward primer  1		ATGACAGACACGACGTTGCC  20
Template		1405472  ..C..G..GGT........G  1405453


product length = 1630
Features associated with this product:
   dihydrolipoamide dehydrogenase

   hypothetical protein

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		553845  TG.T.G.C........G...  553864

Forward primer  1	   ATGACAGACACGACGTTGCC  20
Template		555474  GCC.GTTC........C...  555455


product length = 4952
Features associated with this product:
   nickel-transport integral membrane protein

   short chain dehydrogenase

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3172679  G.G..C...GAC........  3172660

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3167728  GCC.......TG........  3167747


product length = 6002
Features associated with this product:
   mannosyltransferase

   pterin-4-alpha-carbinolamine dehydratase

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		1292184  CGTCG........GC.G...  1292165

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		1286183  GCCTGG...G.........A  1286202


product length = 893
Features associated with this product:
   integral membrane protein

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		682781  .....C.GTGC........A  682762

Reverse primer  1	   TTAATTGCCCGTCTGGTCTG  20
Template		681889  A.C...T.GT........A.  681908


product length = 5280
Features associated with this product:
   MerR family transcriptional regulator

   integral membrane protein

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3726125  AGCT..C...........A.  3726106

Reverse primer  1		TTAATTGCCCGTCTGGTCTG  20
Template		3720846  AGGTG..G.T........A.  3720865


Note the different Tm calculation used by the Primer BLAST program...  I always anneal at about two degrees under the Primer3 Tm, and it's worked well for me....


Greatly appreciated, this has cleared up things a ton for me! I never thought a Red Sox fan would've helped me after last weekend  ;)
One more question though, and that's it, I promise, I noticed you have the reverse primer as " TTAATTGCCCGTCTGGTCTG" why wouldn't it be "GTCTGGTCTGCCCGTTAATT" instead? Why is the stop codon in the beginning of that sequence instead of the end of that sequence? That confuses me a little. Other than that, I can just throw on the vector overhang sequence and be OK correct? Thanks again!

#15 eldon

eldon

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 63 posts
0
Neutral

Posted 13 August 2009 - 10:53 AM

it's a common mistake people make when first learning how to design effective primers. as a result, the pcr fails.

remember that the reverse primer 5' end is actually priming from the stop codon. you have to "flip" the primer around in your "mind's eye" so to speak.

5'TTAATTGCCCGTCTGGTCTG3' will touch down in this orientation 3'GTCTGGTCTGCCCGTTAATT5'

which looks like this:

5'CAGACCAGACGGGCAATTAA3'
3'GTCTGGTCTGCCCGTTAATT5'

Edited by eldon, 13 August 2009 - 10:54 AM.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.