Using BLAST to check primers
#1
Posted 11 August 2009 - 08:37 AM
#2
Posted 11 August 2009 - 09:24 AM
http://insilico.ehu....o=Mycobacterium
Hope this helps....
#3
Posted 11 August 2009 - 11:55 AM
Edited by NYYFan, 11 August 2009 - 11:56 AM.
#4
Posted 11 August 2009 - 04:32 PM
Also, are you using Primer BLAST?
#5
Posted 11 August 2009 - 06:51 PM
HomeBrew, on Aug 11 2009, 05:32 PM, said:
Also, are you using Primer BLAST?
I've tried the primer blast but the problem is my primers have to have a certain overhang because of the vector I'm using. I have to have primers at each end of the gene for this. When I use primer blast they give me primers at various locations throughout the gene. I've never done primer design before and was kind of thrown into this on my own and am trying to learn as much as I can without having to ask for serious help from the postdocs around the other labs in the building. I'm getting different results now then what I was getting earlier... this is frustrating. So what I'm doing is going to nucleotide blast --> Putting my primer sequence in the "Enter Query Sequence" box and then putting in my organism in the "Choose Search Set" area. I then BLAST and get my "hits." I just got over 4000 hits for my primer, my target gene was first with a score of 42.1 (about 21/21 matches) and 100% identity, all the other matches were mostly 100% identity's but had scores of about 20 (matches of 13/13 or less). Less of my primer sequence matched them. Am I going about this the right way? It seems like I'm making this harder than it really is haha. Thanks for everything so far.
Edited by NYYFan, 11 August 2009 - 06:52 PM.
#6
Posted 12 August 2009 - 04:17 AM
This second point is why I don't bother to check my primers by BLAST (BTW, I've designed and used thousands of primers). The value of BLASTing your primers is diminished by the fact that even if BLASTing shows a good match -- say 20 of 21 bases -- if the 3' base is wrong, the primer will fail. So there is a disconnect between a degree of identity match and what will really work in PCR, which really reduces the usefulness of performing this step.
The proof is in the pudding, as they say -- the way I find out if my primers are any good is to use them.
You said your PCR "turned out like garbage". No amount of BLASTing is going to fix that, so let's back up a bit. How did you design your primers? What were your PCR conditions? How much template did you use? Define "turned out like garbage".
#7
Posted 12 August 2009 - 06:12 AM
HomeBrew, on Aug 12 2009, 04:17 AM, said:
This second point is why I don't bother to check my primers by BLAST (BTW, I've designed and used thousands of primers). The value of BLASTing your primers is diminished by the fact that even if BLASTing shows a good match -- say 20 of 21 bases -- if the 3' base is wrong, the primer will fail. So there is a disconnect between a degree of identity match and what will really work in PCR, which really reduces the usefulness of performing this step.
The proof is in the pudding, as they say -- the way I find out if my primers are any good is to use them.
You said your PCR "turned out like garbage". No amount of BLASTing is going to fix that, so let's back up a bit. How did you design your primers? What were your PCR conditions? How much template did you use? Define "turned out like garbage".
First off, thank you very much for the reply!
When I say my PCR turned out like garbage, basically I was amplifying the wrong region, I was getting a strong band around the 650 bases region whereas my desired product should be ~2.5 kb. The vector I'm using is a pET 46 eK/LIC vector, there are no restrcition enzymes involved in this vector, it is an open vector which contains overhangs in which my primers must have complementary base pairs too. The first 12 or so bases of both the forward and reverse primers are already "pre-chosen" if you will. So my forward primer sequence would have to start GACGACGACAAGATG..... and then into my gene. The reverse primer has to end with ...GGCCCGAAGAGGAG with having the base pairs of the gene at the beginning of that sequence. Initially I just took both of those sequences and went about 10 more base pairs into the gene and tried those primers, those failed as I previously described. I'm cloning out of the gDNA of the H37Rv strand of M. Tuberculosis, which is probably making this more difficult than if I were cloning out of a plasmid or something. If this turns out to be a problem with the vector I'm using, I may have to use another vector. My PCR conditions were as follows:
1) initial denat. for 10 mins.
2) denat. for 10 s
3) annealing: 15 s at 62, 65, and 68 degrees (3 different rxns)
4) extention at 72 for 1 min. 30 s
5) repeat 2-4 30x
6) final extension for 10 mins at 72
7) hold at 4
I used ~100 ng of template DNA and also 5% DMSO
Thanks again!
#8
Posted 12 August 2009 - 07:01 AM
what PCR mix are you using? plain old taq or a proofreading taq? a proofreader is ideal...something like Pfu turbo.
10 min. initial denature seems ok...might be a little long...i use 3-5 min.
try 30 sec. 94C denature.
try 20-30 sec. annealing but start at the high temp and proceed to the lower temp..touchdown pcr. starting lower will contribute to non-specific amplification. 68C is high and at this temp your taq is working just as well as at 72C.
depending on your taq...amplification time should generally be 1 min/kb. so you should be trying a 2 min. 30 sec amplification.
amount of starting material will dictate the number of cycles...35 seems a good start..but without a proofreader, extending the cycles may cause over-amplification of your product and increased error incorporation at 2.5 kb.
you can hold at 12-16C...it's better for your machine, especially if you're holding overnight.
the best PCR cloning vector i have ever used is called pJET (fermentas). the ligation is blunt but all your colonies have insert. your fragment when ligated into the vector disrupts a gene that when expressed in bacteria kills the cells. re-ligated vector prevents the cells from growing. the only chance for a false positive might come from cloning unpurified PCR product.
Edited by eldon, 12 August 2009 - 07:02 AM.
#9
Posted 12 August 2009 - 07:20 AM
eldon, on Aug 12 2009, 07:01 AM, said:
what PCR mix are you using? plain old taq or a proofreading taq? a proofreader is ideal...something like Pfu turbo.
10 min. initial denature seems ok...might be a little long...i use 3-5 min.
try 30 sec. 94C denature.
try 20-30 sec. annealing but start at the high temp and proceed to the lower temp..touchdown pcr. starting lower will contribute to non-specific amplification. 68C is high and at this temp your taq is working just as well as at 72C.
depending on your taq...amplification time should generally be 1 min/kb. so you should be trying a 2 min. 30 sec amplification.
amount of starting material will dictate the number of cycles...35 seems a good start..but without a proofreader, extending the cycles may cause over-amplification of your product and increased error incorporation at 2.5 kb.
you can hold at 12-16C...it's better for your machine, especially if you're holding overnight.
the best PCR cloning vector i have ever used is called pJET (fermentas). the ligation is blunt but all your colonies have insert. your fragment when ligated into the vector disrupts a gene that when expressed in bacteria kills the cells. re-ligated vector prevents the cells from growing. the only chance for a false positive might come from cloning unpurified PCR product.
The GACGACGACAAG sequence is to code for an enterokinase site to where I can cleave off the N-terminal his-tag after protein purification. I've tried adding quite a few more nucleotides to the ends of the primers, but I start approaching a Tm over 80 before too long (at about 32 b.p.), I guess b/c it's so GC rich. I am using the Phusion High Fidelity PCR Mater-Mix kit by Finnzymes for my rxns. and am basically following their protocol for the PCR conditions, I'm not exactly which kind of Taq polymerase it uses. I usually take my rxns. out within 30 mintues after they're done, but if I ever leave overnight I will definitely keep the higher temperature in mind.
I have come up with this for the primers:
Forward primer: ACGACGACAAGATGACAGACACGACGTTGC
Reverse primer: GTCTGCCCGTTAATTGGCCCGAAGAGGAG
The bolded parts are the parts I must have for the vector overhangs, the non-bolded parts are from the gene itself.
Both have a Tm of ~79 C, but I'm still not so sure they will work too great for my strain. Maybe I'll just bite the bullet and order and try them.
Thanks!
Edited by NYYFan, 12 August 2009 - 07:22 AM.
#10
Posted 12 August 2009 - 09:48 AM
NYYFan, on Aug 12 2009, 10:12 AM, said:
This is likely your problem -- you in essence designed a 10-bp primer, and I'm not suprised that the PCR looked horrible. What you need to do is design your primers first (I usually use 24 bp, but anything from 20 bp - 30 bp usually works well), and then add the 5' sequences you need on to them before ordering them.
Look at it this way. I don't use the vector system you describe, but I almost always add 10 bases to the 5' end of my primers (a six-bp restriction site and 4 irrelevant 5' bases to allow the enzyme to cut efficiently). These 10 bases are added *after* I've selected my 24-bp primers on the basis of Tm, secondary structure considerations, uniqueness of sequence, position on template, etc. -- right before I order them, I tack the ten 5' bases on.
How are you selecting your primers? If you're eyeballing them, I suggest strongly that you instead use a primer design program (I use Primer3). Design your primers without regard for the 5' sequences you need. When you have a pair that are a good match as to Tm etc., and prime where you need them to, and look good in BLAST (if you're going to do that), *then* add your 5' bases required by your vector and order them.
I ran the primer sequences you provided above without the 5' extensions. Here's what I got:
Primer pair 1
Sequence (5'->3') Length Tm GC%
Forward primer ATGACAGACACGACGTTGC 19 52.89 52.63%
Reverse primer GTCTGCCCGTTAATT 15 41.25 46.67%
Products on target templates
--------------------------------------------------------------------------------
>NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome
product length = 5631
Features associated with this product:
PPE family protein
PPE family protein
Forward primer 1 ATGACAGACACGACGTTGC 19
Template 2163152 ...C.G.G.C......... 2163170
Reverse primer 1 GTCTGCCCGTTAATT 15
Template 2168782 CA.AC.........A 2168768
product length = 2034
Features associated with this product:
long-chain-fatty-acid--[acyl-carrier-protein] ligase
acyl-CoA dehydrogenase
Forward primer 1 ATGACAGACACGACGTTGC 19
Template 1509566 TG.G.G...G........A 1509584
Forward primer 1 ATGACAGACACGACGTTGC 19
Template 1511599 CCCGTT.........C... 1511581
product length = 5291
Features associated with this product:
hypothetical protein
isopentenyl-diphosphate delta-isomerase
Reverse primer 1 GTCTGCCCGTTAATT 15
Template 1976270 CCA.T.......... 1976256
Reverse primer 1 GTCTGCCCGTTAATT 15
Template 1970980 ACG..G......... 1970994
So, the Tm's of your forward and reverse primers are 52.89 and 41.25, respectively -- too low. Also, your primer sequences don't match anything on the Mycobacterium tuberculosis H37Rv genome completely. This is also a problem...
#11
Posted 12 August 2009 - 10:51 AM
HomeBrew, on Aug 12 2009, 09:48 AM, said:
NYYFan, on Aug 12 2009, 10:12 AM, said:
This is likely your problem -- you in essence designed a 10-bp primer, and I'm not suprised that the PCR looked horrible. What you need to do is design your primers first (I usually use 24 bp, but anything from 20 bp - 30 bp usually works well), and then add the 5' sequences you need on to them before ordering them.
Look at it this way. I don't use the vector system you describe, but I almost always add 10 bases to the 5' end of my primers (a six-bp restriction site and 4 irrelevant 5' bases to allow the enzyme to cut efficiently). These 10 bases are added *after* I've selected my 24-bp primers on the basis of Tm, secondary structure considerations, uniqueness of sequence, position on template, etc. -- right before I order them, I tack the ten 5' bases on.
How are you selecting your primers? If you're eyeballing them, I suggest strongly that you instead use a primer design program (I use Primer3). Design your primers without regard for the 5' sequences you need. When you have a pair that are a good match as to Tm etc., and prime where you need them to, and look good in BLAST (if you're going to do that), *then* add your 5' bases required by your vector and order them.
Ahhhh, well that makes things different for me. So when I do my PCR should I make my annealing temperatures close to those of the primer Tm without the added 5' sequences? For example, if my primers without the added 5' sequence have a Tm of 65 and the primers with the added 5' sequence have a Tm of 82, I would use a temperature closer to 65 for my annealing temps? I have been designing my primers by eye, I tried using the Primer BLAST, which I believe is powered by Primer3, and I would get primers which ended up all throughout the gene rather than on the ends of the genes where I need them. Maybe I'll give it another go then. Thanks again for your patience and answers! It's much appreciated.
The gene I'm trying to clone out BTW is gene encoding for gyrA, which are base pairs 7302-9818 of the H37Rv genome. Apparently I have some more work to do here! Something that seems so simple and I'm completely goofing it up!
Edited by NYYFan, 12 August 2009 - 10:53 AM.
#12
Posted 12 August 2009 - 12:53 PM
NYYFan, on Aug 12 2009, 02:51 PM, said:
Correct. Assuming you must begin your forward primer at base 1 (the "A" of the ATG start codon) and end it at base 2517 (the final "A" of the TAA stop codon), and using the sequence found here, about the best you can do is something like:
OLIGO start len tm gc% any 3' seq LEFT PRIMER 1 20 62.18 55.00 5.00 3.00 atgacagacacgacgttgcc RIGHT PRIMER 2517 20 61.02 50.00 4.00 1.00 ttaattgcccgtctggtctg Product Size: 2517 1 atgacagacacgacgttgccgcctgacgactcgctcgaccggatcgaaccggttgacatc >>>>>>>>>>>>>>>>>>>> . . . 2461 gaaagtggcgacgataatgccgtggacgccaacggcgcagaccagacgggcaattaa <<<<<<<<<<<<<<<<<<<<
NYYFan, on Aug 12 2009, 02:51 PM, said:
The easiest way I've found to pick primers when you must have them begin at particular bases is to use the Primer3Plus interface to Primer3 (see an example here). You paste your sequence in the box, select "Cloning" from the Task box in the upper left, and identify where your primers must begin using "{" to mark the position where the forward primer must start and "}" for where the reverse primer must start (without the quotes, of course -- e.g. the sequence in the box for this example would look like {atgaca...aattaa}), set your parameters in the General Settings tab -- for example, I usually set minimum primer length to 20, optimal to 24, and max to 30, but you can leave these at the defaults if you like), and click on the Pick Primers button.
The program will perhaps complain about minor defects in the primer (it yells about the 3' stability of the forward primer above, for example), but since you must have the primers start at a particular base your choices are minimal, and (according to Primer3) this is the best set of primers possible, defects and all (I've never had a problem with some of the errors Primer3 yells about...).
NYYFan, on Aug 12 2009, 02:51 PM, said:
No problem. Someone showed me how to do it long ago, and I'm paying them back -- even if I'm a Red Sox fan and can see Fenway out my lab window...
You design your PCR program around the Tm's shown above. Don't forget to append the sequences you need (in 5'->3' direction) to the primers before you order them!
#13
Posted 12 August 2009 - 07:38 PM
Primer pair 1 Sequence (5'->3') Length Tm GC% Forward primer ATGACAGACACGACGTTGCC 20 55.26 55.00% Reverse primer TTAATTGCCCGTCTGGTCTG 20 52.10 50.00% >NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome product length = 2517 Features associated with this product: DNA gyrase subunit A Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 7302 .................... 7321 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 9818 .................... 9799 product length = 2253 Features associated with this product: hydrolase hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3109070 CG...G.C.G.C........ 3109089 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3111322 GACC...G..A........T 3111303 product length = 1528 Features associated with this product: 3-ketoacyl-(acyl-carrier-protein) reductase acetyl-CoA acetyltransferase Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 290690 CA....CGA.T......... 290709 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 292217 GCG.C.CG...C........ 292198 product length = 5800 Features associated with this product: putative acetyl-CoA carboxylase biotin carboxyl carrier p... anti-sigma factor Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3597669 .GC.GCAC........C... 3597688 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3603468 ACC.GC.....GT....... 3603449 product length = 5019 Features associated with this product: hypothetical protein methanol dehydrogenase transcriptional regulatory protein... Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3531859 .CAG..AC........G... 3531878 Forward primer 1 ATGACAG-ACACGACGTTGCC 20 Template 3536877 -.CT.G.T...A......... 3536858 product length = 4627 Features associated with this product: hypothetical protein hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3114295 TCAT..AT........C... 3114314 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3118921 GGGTAGC....G........ 3118902 product length = 3005 Features associated with this product: acyltransferase transcriptional regulatory protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 1402468 GGCG.GCC........C... 1402487 Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 1405472 ..C..G..GGT........G 1405453 product length = 1630 Features associated with this product: dihydrolipoamide dehydrogenase hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 553845 TG.T.G.C........G... 553864 Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 555474 GCC.GTTC........C... 555455 product length = 4952 Features associated with this product: nickel-transport integral membrane protein short chain dehydrogenase Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3172679 G.G..C...GAC........ 3172660 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3167728 GCC.......TG........ 3167747 product length = 6002 Features associated with this product: mannosyltransferase pterin-4-alpha-carbinolamine dehydratase Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 1292184 CGTCG........GC.G... 1292165 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 1286183 GCCTGG...G.........A 1286202 product length = 893 Features associated with this product: integral membrane protein Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 682781 .....C.GTGC........A 682762 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 681889 A.C...T.GT........A. 681908 product length = 5280 Features associated with this product: MerR family transcriptional regulator integral membrane protein Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3726125 AGCT..C...........A. 3726106 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3720846 AGGTG..G.T........A. 3720865
Note the different Tm calculation used by the Primer BLAST program... I always anneal at about two degrees under the Primer3 Tm, and it's worked well for me....
#14
Posted 13 August 2009 - 07:59 AM
HomeBrew, on Aug 12 2009, 07:38 PM, said:
Primer pair 1 Sequence (5'->3') Length Tm GC% Forward primer ATGACAGACACGACGTTGCC 20 55.26 55.00% Reverse primer TTAATTGCCCGTCTGGTCTG 20 52.10 50.00% >NC_000962.2 Mycobacterium tuberculosis H37Rv, complete genome product length = 2517 Features associated with this product: DNA gyrase subunit A Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 7302 .................... 7321 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 9818 .................... 9799 product length = 2253 Features associated with this product: hydrolase hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3109070 CG...G.C.G.C........ 3109089 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3111322 GACC...G..A........T 3111303 product length = 1528 Features associated with this product: 3-ketoacyl-(acyl-carrier-protein) reductase acetyl-CoA acetyltransferase Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 290690 CA....CGA.T......... 290709 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 292217 GCG.C.CG...C........ 292198 product length = 5800 Features associated with this product: putative acetyl-CoA carboxylase biotin carboxyl carrier p... anti-sigma factor Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3597669 .GC.GCAC........C... 3597688 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3603468 ACC.GC.....GT....... 3603449 product length = 5019 Features associated with this product: hypothetical protein methanol dehydrogenase transcriptional regulatory protein... Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3531859 .CAG..AC........G... 3531878 Forward primer 1 ATGACAG-ACACGACGTTGCC 20 Template 3536877 -.CT.G.T...A......... 3536858 product length = 4627 Features associated with this product: hypothetical protein hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 3114295 TCAT..AT........C... 3114314 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3118921 GGGTAGC....G........ 3118902 product length = 3005 Features associated with this product: acyltransferase transcriptional regulatory protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 1402468 GGCG.GCC........C... 1402487 Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 1405472 ..C..G..GGT........G 1405453 product length = 1630 Features associated with this product: dihydrolipoamide dehydrogenase hypothetical protein Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 553845 TG.T.G.C........G... 553864 Forward primer 1 ATGACAGACACGACGTTGCC 20 Template 555474 GCC.GTTC........C... 555455 product length = 4952 Features associated with this product: nickel-transport integral membrane protein short chain dehydrogenase Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3172679 G.G..C...GAC........ 3172660 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3167728 GCC.......TG........ 3167747 product length = 6002 Features associated with this product: mannosyltransferase pterin-4-alpha-carbinolamine dehydratase Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 1292184 CGTCG........GC.G... 1292165 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 1286183 GCCTGG...G.........A 1286202 product length = 893 Features associated with this product: integral membrane protein Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 682781 .....C.GTGC........A 682762 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 681889 A.C...T.GT........A. 681908 product length = 5280 Features associated with this product: MerR family transcriptional regulator integral membrane protein Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3726125 AGCT..C...........A. 3726106 Reverse primer 1 TTAATTGCCCGTCTGGTCTG 20 Template 3720846 AGGTG..G.T........A. 3720865
Note the different Tm calculation used by the Primer BLAST program... I always anneal at about two degrees under the Primer3 Tm, and it's worked well for me....
Greatly appreciated, this has cleared up things a ton for me! I never thought a Red Sox fan would've helped me after last weekend
One more question though, and that's it, I promise, I noticed you have the reverse primer as " TTAATTGCCCGTCTGGTCTG" why wouldn't it be "GTCTGGTCTGCCCGTTAATT" instead? Why is the stop codon in the beginning of that sequence instead of the end of that sequence? That confuses me a little. Other than that, I can just throw on the vector overhang sequence and be OK correct? Thanks again!
#15
Posted 13 August 2009 - 10:53 AM
remember that the reverse primer 5' end is actually priming from the stop codon. you have to "flip" the primer around in your "mind's eye" so to speak.
5'TTAATTGCCCGTCTGGTCTG3' will touch down in this orientation 3'GTCTGGTCTGCCCGTTAATT5'
which looks like this:
5'CAGACCAGACGGGCAATTAA3'
3'GTCTGGTCTGCCCGTTAATT5'
Edited by eldon, 13 August 2009 - 10:54 AM.













