Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

probe conc. of Asymmetric PCR


  • Please log in to reply
1 reply to this topic

#1 Sonia

Sonia

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 01 August 2009 - 03:22 AM

Does anyone know what concentration I should use for Asymmetirc PCR? Since the probe can't prime to the target (no extra melting peak apper).

Currently, I use
Reverse Primer 500nM
forward primer 100nM
probe 500nM

Thank you

#2 Sonia

Sonia

    member

  • Active Members
  • Pip
  • 8 posts
0
Neutral

Posted 04 August 2009 - 05:36 AM

The unlabelled probe is
5' AAGAGATTCTCACTTGGAATGCTGAA 3'--phos

What is the possible factor that make it can't bind to the sequence?




Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.