help/ correct me ( my 1st attempt at expression , –ve rna virus gene ) on 3 points:[ my 1st post on forum)
1. manual says(see at bottom) – use 5’ dephosphorylated primers only- now funds are low and these are very expensive - can i order normal primers – amplify orf – perform alkaine phospahste( e coli)treatment and then proceed with vector ligation ?
2. manual says – for forward primer only consideration is that 1st amino acid of the ORF should be in frame with initiation codon in vector- I get this . But for reverse primer it says proper translation termination codon sequence must be in amplicon – so the reverse primers I have designed contains TAA + plus few more nucleotides.
I also have reverse primers that are further 100 bp down the gene ORF (amplicon will include gene end + inter genic+ )5’ initiation region of next gene- these are ones I used for intial gene cloning- these are proven & standardidized- can these primers can be used with the forward primer?
3. I think the chemiacally Competant Cells TOP10 (20 vials) with the kit are not viable, they atleast should propagate if not be competent- they are not even growing in normal LB/agar- I have already used up 3 vials to confirm ( i was trying to make our own permanent glycerol stocks ) - will JM107 or dh5ά will work for cloning. ?
(supporting text) FROM KIT MANUAL:
TOPO® Cloning Site of pcDNA4/HisMax©-A TOPO® T/A mammalian expression vector
Designing Your PCR Primers
The design of the PCR primers to clone your PCR product of interest is critical for proper
expression. When designing your PCR primers, the following factors should be considered:
• The pcDNA4/HisMax©-TOPO® vector is an N-terminal fusion vector that allows your
PCR product to be expressed as a fusion to a peptide containing an ATG initiation
codon, a polyhistidine (6xHis) tag, the Xpress™ epitope, and an enterokinase cleavage
SITE. The TOPO® Cloning site has been designed in such a way that your PCR product
will automatically be cloned in frame with the N-terminal tag if the first three base
pairs of your PCR product constitute a complete codon
• Do not add 5′ phosphates to your primers for PCR. The PCR product synthesized will not
ligate into pcDNA4/HisMax©-TOPO®
• Be sure to include a stop codon for proper translational termination of your gene.
my seqence:
1 acgcttaaca accagatcaa agaagaaaaa gacagcgtca attgcaaagc aaaaatgtaa
61 cacccctaca atggatgccg acaagattgt gttcaaagtc aataatcagg tggtctcttt
121 gaagcctgag attatcgtgg atcaatatga gtacaagtac cctgccatca aggatttgaa
181 aaagccttgt atcaccctag ggaaagcccc cgacttgaac aaagcataca aatcagtttt
241 atcaggcatg aatgccgcca aacttgatcc ggatgatgta tgctcctact tggcagcagc
301 aatgcagttc tttgagggga catgtccgga agactggacc agctatggaa tcctgattgc
361 acgaaaagga gataggatca ccccaaactc tctagtggag ataaagcgta ctgatgtaga
421 agggaattgg gctctgacag gaggcatgga attgacaagg gaccccactg tctctgaaca
481 tgcatcttta gtcggtcttc tcctgagtct gtacaggttg agcaaaatat caggacagag
541 cactggtaac tataagacaa acattgcaga taggatagag cagattttcg agacagcacc
601 ttttgttaag atcgtggaac accataccct aatgacaact cacaagatgt gtgctaattg
661 gagtactata ccgaacttca gatttttggc cggaacctac gacatgtttt tctcacggat
721 tgagcatctg tattcggcaa tcagagtggg cacagtcgtc accgcttatg aagactgctc
781 aggactggta tcgtttacag ggttcataaa gcagatcaat ctcaccgcaa gggaagcaat
841 actatatttc ttccacaaga actttgagga agagataaga agaatgttcg agccagggca
901 agagacagct gttcctcact cttatttcat ccacttccgt tcactaggct tgagtgggaa
961 gtctccttat tcatcgaatg ctgtcggtca tgtgttcaat ctcattcact ttgttggatg
1021 ctacatgggt caagtcagat ctctaaatgc gacggttatt gctgcatgtg cccctcatga
1081 gatgtctgtt ctagggggct atttgggaga ggaattcttc ggaaaaggga catttgaaag
1141 aaggttcttc agagacgaga aagaacttca agaatatgag gcggctgaac taacaaagtc
1201 cgacgtggca ctggcagatg acggaaccgt caactctgat gacgaggact atttctctgg
1261 tgaaaccaga agtccagaag ctgtctatac tcgaatcatg atgaatggag gtcgactgaa
1321 gagatctcat atacggagat atgtctcagt cagttccaat catcaagccc gtccaaactc
1381 attcgccgaa tttttaaaca agacatattc gagtgactca taaggagttg attgacaggg
1441 tgccagaaat ctatagattg tatatatcca tcatgaaaaa aactaacact cctcctttca
1501 aaccatccca aatatgagca agatctttgt taatccgagt gcaatcagag ccggtctggc
i've design the following:
sense primers:
5' CCT ACA ATG GAT GCC GAC A 3'
5' ACA ATG GAT GCC GAC AA 3'
antisense primers:
5' GATGGTTTGAAAGGAGGAGTGT 3'
5' TTGACGAAGATCTTGCTCAT 3 '
are these ok ?can someone recheck/ redesign these .. i am not very confident...thanks.
0
No replies to this topic
