Colony PCR
#1
Posted 23 July 2009 - 02:26 PM
I used pGEM T easy for cloning my DNA and did transformation (blue-white screening) and then I picked 5 white colonies from my plate and did PCR using SP6 and T7 primers but I did not see any bands on my gel, I repeated this with new colonies but still the same result. Any idea why The PCR may not have worked at all? Also, what can I do now, since I do not have any more white colonies left, will I need to start over from my ligation?
Thanks for your help,
-Uma
#2
Posted 23 July 2009 - 03:54 PM
umam, on Jul 23 2009, 02:26 PM, said:
I used pGEM T easy for cloning my DNA and did transformation (blue-white screening) and then I picked 5 white colonies from my plate and did PCR using SP6 and T7 primers but I did not see any bands on my gel, I repeated this with new colonies but still the same result. Any idea why The PCR may not have worked at all? Also, what can I do now, since I do not have any more white colonies left, will I need to start over from my ligation?
Thanks for your help,
-Uma
Unless this PCR is standardized in your lab, it is possible that you are making some PCR mistake. Do the same PCR on some other clone with a proven insert. Otherwise,
1. You can digest the plasmids with appropriate rest. enzymes and see if they have insert.
2. You can also sequence these plasmids.
#3
Posted 23 July 2009 - 04:45 PM
#4
Posted 23 July 2009 - 08:56 PM
I'd also say that your PCR is the problem. I always had problems with T7/Sp6 on pGEM, so I changed my primer to forward 5' GATGTGCTGCAAGGCGATTA 3' and reverse 5' CTTCCGGCTCGTATGTTGTG 3', annealing temp 60C, product size 338bp (with no insert). If you continue using pGEM for cloning, I strongly recommend to purchase them.
You don't need to make a new cloning, just let your plates, where you picked your colonies from, overnight at room temperature. The next day you'll have them again! Miracle! Actually, you should make a backstock for every colony you pick (pick colony into the water (only!) for PCR first, then into second plate with LB). 50ul in a 96well plate works pretty well for that. Keep that plate until sequencing finished.
Cheers,
Minna
#5
Posted 23 July 2009 - 09:53 PM
I pick the colony and grow overnight. I use 1µl of this culture for further PCR. If my insert is less than 3.5kb then I would use the primers I used for amplifying the insert. I have never used T7 primers. but the reason for this is, I use this vector as just carrying vector and don't care which direction my insert is getting in there. I will cut out the insert later to be inserted in another vector.
The advantage of using the same primers as that of for your insert is, you know the PCR conditions very well (as you have successfully amplified that piece), so you don't waste your time anymore.
Just one caution, I keep very first step of PCR as 95°C for 5 min. instead of regular 3 min. just to make sure that all colonies are lysed.
#6
Posted 24 July 2009 - 04:00 AM
You will see this when you do a miniprep and your preps of the white colonies run faster than your empty vector. Additionally you may check the presence of insert by restriction as Cellcounter suggested or PCR with insert specific primers.
I made the experience that my white colonies are all broken vector when their number is quite low...
#7
Posted 25 July 2009 - 02:44 PM
Of all the protocols I'm familiar with, colony PCR is the least reliable. You may want to try other variations on the colony PCR protocol to see what works for you. Mini-preps may be preferable if colony PCR woes persist.
#8
Posted 25 July 2009 - 11:19 PM
Way not use the primers that you used originally for the amplification? They will tell you if you've got the insert or not.
#9
Posted 28 July 2009 - 05:57 AM
Why do you think that colony PCR is the "least reliable"? I'm doing colony PCR since 3 years, amplifying and sequencing inserts up to 4kb in one go and never really had problems. From my experience, it saves 95% of the cost and a whole day of work if you do not do miniprep. I do miniprep after colony PCR and sequencing, because my supervisor wants me to do miniprep. And to check the integrity of the backbone... but all other steps, like confirmation of ligation, direction, sequence, I'd strongly recommend to do PCR, if you want to save money and time. If you mix up colony PCR, then you'd also mix up miniprep.
I never saw the advantage of doing a miniprep first, sorry. Maybe you can explain to me?
Well, actually, my supervisor said once: "Do miniprep, because it slows you down. That gives you time to THINK!". Now, that was the best reason I ever heard for doing miniprep before sequencing.
Cheers,
Minni
#10
Posted 28 July 2009 - 01:33 PM
How is this possible, if I can see a band after PCR how can I not see it after cleaning it up?
I have re-streaked the white colonies on my plate on LB+amp+Xgal+IPTG to see if anything grows.Will keep you all posted.
Also- colony PCR is supposed to be reliable, I know a lot of peple who do it regularly,why would you call it unreliable?
I have another question, how do I understand the orientation of my insert when I use insert specific primer with Sp6/T7?
Thanks again,
-Uma
#11
Posted 28 July 2009 - 01:55 PM
umam, on Jul 28 2009, 04:33 PM, said:
I have another question, how do I understand the orientation of my insert when I use insert specific primer with Sp6/T7?
Thanks again,
-Uma
I've tried colony PCR a number of times, and had it work only once. I now just do a culture and a plasmid prep. I have a feeling I was using too much colony, but I'm not sure.
#12
Posted 28 July 2009 - 06:22 PM
umam, on Jul 28 2009, 01:33 PM, said:
Thanks again,
-Uma
You can't. You either need to sequence your PCR product, or do a colony PCR using Sp6 and gene-specific reverse primer. If you get a PCR product, you'll know the orientation of your insert.
Cheers,
Minna
#13
Posted 29 July 2009 - 04:59 AM
Minna, on Jul 28 2009, 10:22 PM, said:
umam, on Jul 28 2009, 01:33 PM, said:
Thanks again,
-Uma
You can't. You either need to sequence your PCR product, or do a colony PCR using Sp6 and gene-specific reverse primer. If you get a PCR product, you'll know the orientation of your insert.
Cheers,
Minna
Thats what, if I use Sp6 and gene-specific reverse primer, how do I understand the orientation?
#14
Posted 29 July 2009 - 05:27 PM
Thats what, if I use Sp6 and gene-specific reverse primer, how do I understand the orientation?
[/quote]
So if you have Sp6-insert-T7 and you make a PCR with Sp6 and T7, you'll get a product in any case. If you make a PCR with Sp6 and gene-specific reverse primer, you will get a product only if your insert is in "forward" orientation. If it is reverse, then both primer are amplifying in the same direction, and you won't get a PCR product.
I hope I could make myself clear...
Cheers,
Minna
#15
Posted 25 September 2009 - 05:55 PM













