25 replies to this topic

[fishdoc]

Thanks again for the answer.

And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)



However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.

I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.

[lucilius]

Thanks again for the answer.

And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)



However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.

I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.

Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?

You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?

[fishdoc]

Thanks again for the answer.

And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)



However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.

I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.

Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?

You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?

OK, I see. To be able to do that, your bacterium must be able to take up environmental DNA. They talk about it in the video about the DNA binding a receptor and nucleases degrading one strand. In that instance, you're still adding dsDNA, but the action of the bacterium makes it ssDNA. I'm not sure that you can add ssDNA and get the same result, but maybe. I'm not that familiar with bacteria that are naturally competent for environmental DNA uptake.

Yes, I mean bacterial conjugation. My bacterium doesn't take kindly to electroporated DNA (linear or circular), but accepts plasmids by conjugation pretty well.

For what you're talking about, it all depends on what species of bacteria you're working with and what capabilities is has for taking up environmental DNA.

As for your last question, yes, that's what we do. We clone into plasmids carried by E. coli, then transfer the plasmids (by electroporation) to a conjugation strain of E. coli (usually SM10 lambda pir, but sometimes S17 1 lamda pir), and mate that with our bacteria, and the plasmid gets transferred by bacterial conjugation. Once the plasmid is in the target strain, it does not replicate without the lambda pir protein, and either recombines or gets lost by dilution when the bacteria replicate.

There are two possibilities for homologous recombination. A single-crossover event will result in the entire plasmid integrating into the genome. A double-crossover will result in just a piece of the plasmid integrating, which is how the mutation gets transferred.

[lucilius]

Thanks again for the answer.

And about homologous recombination: I have checked it, and know it, however it is always explained with 2 ds-DNA ; = + = ==> ..)



However I am also looking into it in the case of 1 ds dna (the initial ds dna of the bacteria and the new single stranded dna you insert , because I am also interested in the insertion of naked dna , not using a plasmid)
And about this I only seem to find very basic information like: the single straned dna enters the cel and is then integrated in the original chromosome by homologous recombination.
And then I always stumble back at the part where you have 2 ds dna pieces, here you onyl have 1 , so I wonder how you get that 1 piece in or on the double stranded piece of dna.

I know of homologous recombination with a linear piece of dsDNA, but have not heard of it being done with ssDNA. Basically you have a piece of dsDNA like a PCR product and you electroporate it into the bacterium and plate on the proper media to select for homologous recombination. The bacterium I work with will not take up linear dsDNA well, so we need to conjugate a plasmid.

Yeah, well thats my question too: I know about 2 ds pieces, then homologous recombination, but what when you have 1 ds dna (the chromosome) and 1 single stranded piece of dna!
(I even found a flash animation about it: 1single stranded + 1 ds dna
And by conjugate, you do mean the proces of bacterial conjugation?

You mean you need to insert the plasmid in a bacterium that does have the ability to uptake the plasmid and then you use this bacterium, that is capable to conjugate with the other one, to get the plasmid in the second bacterium?

OK, I see. To be able to do that, your bacterium must be able to take up environmental DNA. They talk about it in the video about the DNA binding a receptor and nucleases degrading one strand. In that instance, you're still adding dsDNA, but the action of the bacterium makes it ssDNA. I'm not sure that you can add ssDNA and get the same result, but maybe. I'm not that familiar with bacteria that are naturally competent for environmental DNA uptake.

Yes, I mean bacterial conjugation. My bacterium doesn't take kindly to electroporated DNA (linear or circular), but accepts plasmids by conjugation pretty well.

For what you're talking about, it all depends on what species of bacteria you're working with and what capabilities is has for taking up environmental DNA.

As for your last question, yes, that's what we do. We clone into plasmids carried by E. coli, then transfer the plasmids (by electroporation) to a conjugation strain of E. coli (usually SM10 lambda pir, but sometimes S17 1 lamda pir), and mate that with our bacteria, and the plasmid gets transferred by bacterial conjugation. Once the plasmid is in the target strain, it does not replicate without the lambda pir protein, and either recombines or gets lost by dilution when the bacteria replicate.

There are two possibilities for homologous recombination. A single-crossover event will result in the entire plasmid integrating into the genome. A double-crossover will result in just a piece of the plasmid integrating, which is how the mutation gets transferred.

I was indeed talking about ds dna at the start, but when it enters the bacterium it becomes ss dna and then you have homologous recombination with ds dna and ss dna...
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.

I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?

PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....

[fishdoc]

I was indeed talking about ds dna at the start, but when it enters the bacterium it becomes ss dna and then you have homologous recombination with ds dna and ss dna...
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.

I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?

PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....

I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.

For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.

For you last question, there is most definitely a way to direct homologous recombination... by using homologous sequences.

For a short example, say your gene sequence is:

AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG


and you want to remove the string of 4 Cs in the middle. You make a construct that is AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG (where the (-) is the deletion). That sequence flanking the deletion will direct where recombination occurs. Recombination will only occur in areas where there is homologous DNA present.

However, if you're talking about transposons, phage, or other types of DNA, they can insert into non-homologous regions, but for the scope of what we're talking about here, the sequence flanking the mutation will direct where the recombination occurs.

For us, we need at least 500 bp on either side of a mutation for efficient recombination to occur. Sometimes up to 1 kb is needed. However, there are strains of E. coli (I think) and Salmonella (for sure) that have a lambda red phage that allows for recombination to occur with as few as 40 bp or so of flanking sequence.

Again, I don't know how all this translates to ssDNA recombining, but this is basically how it works for dsDNA, either linear or in a plasmid, recombining with genomic.

[lucilius]

I was indeed talking about ds dna at the start, but when it enters the bacterium it becomes ss dna and then you have homologous recombination with ds dna and ss dna...
and thats where I am getting confused since homologous recombination is always explained with 2 ds dna pieces.

I understand that the with a double crossover only a piece of the plasmid is integrated, but you state that by single crossover the entire plasmid wille be integrated in the genome, isnt it possible that a little part of the plasmids dna isnt integrated?

PS. it is with double crossover that the mutation is tranferred, but there is absolutly no way how you can direct this, so its possible that the mutation isnt transferred at all then?
You do not know wich piece is tranferred....

I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.

For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.

For you last question, there is most definitely a way to direct homologous recombination... by using homologous sequences.

For a short example, say your gene sequence is:

AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG


and you want to remove the string of 4 Cs in the middle. You make a construct that is AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG (where the (-) is the deletion). That sequence flanking the deletion will direct where recombination occurs. Recombination will only occur in areas where there is homologous DNA present.

However, if you're talking about transposons, phage, or other types of DNA, they can insert into non-homologous regions, but for the scope of what we're talking about here, the sequence flanking the mutation will direct where the recombination occurs.

For us, we need at least 500 bp on either side of a mutation for efficient recombination to occur. Sometimes up to 1 kb is needed. However, there are strains of E. coli (I think) and Salmonella (for sure) that have a lambda red phage that allows for recombination to occur with as few as 40 bp or so of flanking sequence.

Again, I don't know how all this translates to ssDNA recombining, but this is basically how it works for dsDNA, either linear or in a plasmid, recombining with genomic.

Ok, you have: AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG , but want to get rid of the 4c's, you make this: AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG

Is this AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG then lineair dna or circular? And the - (the deletion) is this then an opening in that dna sequence or is are the 2 T's attached to eachother? (wich seems strange.)

Or is there still a "hole" between those 2 T's and does the recombination starts at both sides of that "hole" one recombination going to the right (TGAAAGTGACTACGAGGG ==>, starting at the T) and the other one going to the left (AGTCTGCGATAGCAGAGT , starting at the T and goinh <==== like this)

I'm not familiar with how ssDNA recombines with dsDNA. I'm sure there are enzymes involved, but I can't explain the mechanism. It may be similar to, or the same as when dsDNA recombines. I don't know.

I'll have to look into this then, because its this proces I really need to understand.

For your second question, for a single crossover event, the whole plasmid integrates. At least that's how I've always known it to occur. I don't see how a piece of the plasmid wouldn't integrate during a single crossover event.

Eum, single cross over, you do mean single point crossover then? like in this image:

Edited by lucilius, 24 July 2009 - 11:10 AM.

[fishdoc]

Ok, you have: AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG , but want to get rid of the 4c's, you make this: AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG

Is this AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG then lineair dna or circular? And the - (the deletion) is this then an opening in that dna sequence or is are the 2 T's attached to eachother? (wich seems strange.)

Or is there still a "hole" between those 2 T's and does the recombination starts at both sides of that "hole" one recombination going to the right (TGAAAGTGACTACGAGGG ==>, starting at the T) and the other one going to the left (AGTCTGCGATAGCAGAGT , starting at the T and goinh <==== like this)

It can be either linear or circular. In my case, it has to be in a plasmid, but as I said earlier, some bacteria can accept linear DNA by electroporation.

The 2 Ts are attached to each other. It's a deletion mutant, so you delete a portion of the gene. Alternatively, a resistance marker could be put in there leading to it looking like this: AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG

As far as the recombination, the crossover ideally occurs on each side of the mutation, leading to a double crossover event and allelic exchange. If a single crossover event occurs, and the construct is of plasmid origin, the single crossover results in integration of the plasmid.

There can't be a hole between the bases, I just put the (-) there to denote where the deletion occurred.

Eum, single cross over, you do mean single point crossover then? like in this image:

This site will explain much of what I'm talking about, but with images. http://www.sci.sdsu....ec-genetic.html

http://www.sci.sdsu....e-exchange.html

Edited by fishdoc, 24 July 2009 - 11:51 AM.

[lucilius]

It can be either linear or circular. In my case, it has to be in a plasmid, but as I said earlier, some bacteria can accept linear DNA by electroporation.

The 2 Ts are attached to each other. It's a deletion mutant, so you delete a portion of the gene. Alternatively, a resistance marker could be put in there leading to it looking like this: AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG

As far as the recombination, the crossover ideally occurs on each side of the mutation, leading to a double crossover event and allelic exchange. If a single crossover event occurs, and the construct is of plasmid origin, the single crossover results in integration of the plasmid.

There can't be a hole between the bases, I just put the (-) there to denote where the deletion occurred.

Eum I see, I'll have to look into it to fully understand it.

basically, if I am understanding it correct, you kinda "swap" the gene that you want to delete with what you put between the 2 pieces you have next to the deletion (or knamycin)

==> AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG and you use this to swap the kanamycin with the 4 c's , right?

This I understand, but when you have a deletion it seems strange to me that AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG will attach itself to the AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG dna piece, since you have those 4 cccc's extra in the middle or is it that the (by example) right part TGAAAGTGACTACGAGGG (from the one you created with the deletion) will be attached to the TGAAAGTGACTACGAGGG part of the original and then start the recombination, ending with the final part (the left part of the created piece of dna) AGTCTGCGATAGCAGAGT and this ending with that last T , meaning that those 4 CCCC's in the middle will not be replicated and thus be lost.

or is this a wrong view?



I'll check those websites.

Damn its hard to undertand all this when you never had any real molecular biology.

If I would have know this would be all part of my thesis

I am a chemistry major in polymers lol

[fishdoc]

basically, if I am understanding it correct, you kinda "swap" the gene that you want to delete with what you put between the 2 pieces you have next to the deletion (or knamycin)

==> AGTCTGCGATAGCAGAGT(kanamycin)TGAAAGTGACTACGAGGG and you use this to swap the kanamycin with the 4 c's , right?

This I understand, but when you have a deletion it seems strange to me that AGTCTGCGATAGCAGAGT-TGAAAGTGACTACGAGGG will attach itself to the AGTCTGCGATAGCAGAGTCCCCTGAAAGTGACTACGAGGG dna piece, since you have those 4 cccc's extra in the middle or is it that the (by example) right part TGAAAGTGACTACGAGGG (from the one you created with the deletion) will be attached to the TGAAAGTGACTACGAGGG part of the original and then start the recombination, ending with the final part (the left part of the created piece of dna) AGTCTGCGATAGCAGAGT and this ending with that last T , meaning that those 4 CCCC's in the middle will not be replicated and thus be lost.

or is this a wrong view?

It may seem strange, but it does work. The non-complementary DNA (in this case, the 4 Cs) will form a loop when the plasmid binds complementary DNA in the genome. Well, maybe not even a loop, but the 4 Cs were an example. Many times you'll actually delete a large chunk of the DNA, not just a few bases. However, sometimes deleting or changing a few bases also gets done, although I haven't done that sort of mutation.

As for you explanation, I think that's at least partially right. The crossover events result in replication, and if the crossover occurs, those 4 Cs are not included in replication and are lost, resulting in the mutation.

[lucilius]

Ok, I see.
thanks a lot for your help.

[pito]

A bit late, but you might wanne check the following article.
Its an open source article so no need to be a university student or something.