Jump to content


- - - - -

Bisulfite Sequencing PCR


4 replies to this topic

#1 Salty

    member

  • Members
  • Pip
  • 2 posts

Posted 21 July 2009 - 05:44 AM

Hi,

I have some problems with my BSP, but did not found any appropriate topics in the archives. I am working on BSP for over one year. Several weeks ago I tested a new BSP primer pair and it worked very well. I tried direct sequencing and the peaks were top! Therafter I wanted to amplifiy my samples, but I got no product. After some discouraging efforts, I prepared new bisulfite DNA (EZ DNA Gold Kit, ZYMO). Also I ordered new vials of my primers and changed my PCR reagents (Polymerase, MgCl2, 10x Buffer, dNTP). But I got no product anymore.
So what could be the problem? I have no idea. Maybe it is summer and it became very hot during the last weeks - also in the lab. Could that have any influences? Is a new primer pair the only solution?
Here are my work conditions. It may help you to answer me.

This is my sequnce (bisulfite converted):
TTAGTTTTTTTATTGGTGTTGTTAGGGTTGGGTAGGAGGTGGGAGTCGTTAGGAGCGGTTTTATTTCGGTCGTCGTCGAT
AGTTAATGGCGCGGCGTTATTCGGGGGTGTGTTTCGAGCGGGGCGGGGTTTGGGCGGGGTTTTTTTTCGGGTTTTAAGCGT
TCGCGGTTTGAGTTTTTCGGTTCGGGAGGGGGGTAGAGGGGCGGTTCGTGTCGTAGGGGCGCGGTTGGTACGGGCGCGGGG
AGACGGCGTCGGGTTTGGGTAGGGGACGTAGCGGTTTTACGGCGAGGGTAGTCGGCGGCGGGGGCGGAGGCGGTCGTAAGC
GTTTTGTTCGGCGTCGTTTTTTTTAGCGCGTTGGTTCGGGGGATCGGTAGGCGGCGGATCGTAGTTTTAGGTGTTAGGCGG
CGGGCGTGCGCGCGCGGGGGTTCGCGGGTAGGTTTTTTTCGATTTCGGATTTCGAGCGGCGGCGGACGGGGAGGGGTCGGG
CGGCGTATGCGCGGGGTTTAGGGGCGCGGGTGAGGGCGTTTGTCGCGGGTTCGTGTTGGGAGATTTCGGGTTTTTGGGGTC
GTTTTTAGTTCGGTTTTTTTTGGAGCGTTTAGGGTTTTTTCGGAGTTTCGGCGTTCGTAGTTGTCGGTGGGGTTGGGGGTT
GGGTAGAAGTGGAGGT

This are the primers:
FP: 5' TTAGTTTTTTTATTGGTGTTGTTAGGG 3'
RP: 5' ACCTCCACTTCTACCCAACC 3'

MasterMix:
2.5µl 10x Buffer
2.5µl dNTP-Mix
2.5µl 25mM MgCl2
1.25µl FP
1.25µl RP
0.2µl AmpliTaq Gold
5µl 5m Betaine
8.8µl H2O
1µl DNA (30ng)

PCR conditions:
94°C 4min

94°C 1min
63°C 1min
72°C 1.30min
40 cycles

72°C 8min

I am looking forward to your answers!
Many Thanks,
Mona

#2 pcrman

    Epigenetist

  • Moderator
  • PipPipPipPipPip
  • 815 posts

Posted 31 July 2009 - 10:25 PM

Hi Mona,

Sorry for the late reply and hope your PCR has worked out. You said you tested the new BSP primer pair and it worked very well. In that case the problem is not at the primers. Your annealling temperature is 63C, which appears too high to me. I usually use a tempeature of around 55C. What templates did you use to test the new primers and what are the samples you are trying to amplify? If you did not see any product after 40 cycles, try reamplifying the product for 25-30 cycles. In most BSP PCR, two rounds of PCR are necessary.

Good luck!

#3 dvddecarvalho

    Enthusiast

  • Active Members
  • PipPip
  • 37 posts

Posted 04 August 2009 - 04:46 AM

pcrman,
what did you mean by reamplifying?
To add more enzyme to entire volume of amplification?
Amplify an aliquote of first round?

Thanks,
Dvd

View Postpcrman, on Jul 31 2009, 10:25 PM, said:

Hi Mona,

Sorry for the late reply and hope your PCR has worked out. You said you tested the new BSP primer pair and it worked very well. In that case the problem is not at the primers. Your annealling temperature is 63C, which appears too high to me. I usually use a tempeature of around 55C. What templates did you use to test the new primers and what are the samples you are trying to amplify? If you did not see any product after 40 cycles, try reamplifying the product for 25-30 cycles. In most BSP PCR, two rounds of PCR are necessary.

Good luck!


#4 methylnick

    Veteran

  • Moderator
  • PipPipPipPipPip
  • 250 posts

Posted 06 August 2009 - 10:14 PM

Take 1ul and reamplify in a second pcr. Your tm is a little high.

#5 Salty

    member

  • Members
  • Pip
  • 2 posts

Posted 02 September 2009 - 12:15 AM

Sorry for answering so late but I was on holiday.

Thank you for your answers! I will try the reamplification.

Concerning the Tm: With every new primer pair I do Temperature Gradient PCR generally from 50 to 65°C (+/- 5°C from the stated Tm). This primer pair worked only above 60°C. We confered from this that the template may form secondary structures (the originally sequence has a cg-content >0.8). Thus we added betaine (normally decreasing Tm).
Concerning the samples: I tested my primers with some bisulfite treated DNA of my original samples. As I thought they work well, I did new bisulfite treatment of all my samples and used that new ones. So one of my intentions was, that the samples were not o.k.. But I did a positive control with the same samples and reagents but with another primer pair. In that case the samples worked well.

Again many thanks for your help!
Mona





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.