Jump to content


- - - - -

Check the primers


4 replies to this topic

#1 prakruti

    member

  • Members
  • Pip
  • 3 posts

Posted 02 July 2009 - 11:22 PM

hi all,

Can anyone please check the BSP primers, I have selected for PCR of my gene. Is the Tm and GC contect alright? I have used meth-primer for designing the primers.

All suggestions and corrections are welcome. and in case my primers are not suitable can anybody help me design the primers.

CCAGTAGAGGGTTATACTTTACTGGGCACAAGTCGTTTATGATAACGAAATTGTAGTTTAATCTGTGAAGAGATGT
GAATGTAACTGAGACACGCTTAAATGGAATATACAGATGAGCTTTATTTTTATATCTGGCATGCTTGGATCCATGCC
GACCCTCCAGCTGCTCGGGCCTGCCCTTAGGGGCTATGGACCGCATGACTCTATCAGCGGCACTGCCACCGCC
GCCGCCTCCGTGCTGCCTGCGTTCCCCGACCATTGATTGGGCCCGGCAGGCGCTTCCTGGGGGCTTCCCT
ACCGGCTCCAGCCCTTGGGATTCGGGAGCGCCCTGCTAGGAAGCCAGAGCCCCGCAGGGGCCGCGGCG
TCCAGGCCGCCTAACGCGCGCCCCTCGCCCGGCGCCCCGAAGCGGCCCCGAGGGGCGGGAGCCGAGG
CGAGCGGCAAGGCCGGGCCGGGGGCGCACAGCGCCCCTAGAAGTGCGGGCTTCCCCCACCCCCGGCA
GCGACCCTACCTCCCGCCCCCGCTGCGTGCGCGCGTGTGTCCGTCTGTCTGTATGCTCTCTCGACGTCAG
TGGGAATTTCCAGCCAGGAA
GTGAGAGAGTGAGCGAGACAGAAAGAGAGAGAAGTGCACCAGCGAGCCGGG
GCAGGAAGAGGAGGTTTCGCCACCGGAGCGGCCCGGCGACGCGCTGACAGCTTCCCCTGCCCTTCCCGTCGGTCG
GGCCGCCAGCCGCCGCAGCCCTCGGCCTGCACGCAGCCACCGGCCCCGCTCCCGGAGCCCAGCGCCGCCGAGGC
CGCAGCCGCCCGGCCAGTAAGGCGGCGCCGCCGCCCGGCCACCGCGCGCCCTGCGCTTCCCTCCGCCCGCGCTGC

Primer Size Tm GC% 'C's Sequence
Left primer 22 58.71 68.18 6 GGTTTGTTTTTAGGGGTTATGG
Right primer 23 54.28 52.17 5 TTCCTAACTAAAAATTCCCACTA
Product size: 418, Tm: 73.5, CpGs in product: 47

Note: 'GTG' next to reverse primer is the transcription start site

Attached File(s)

  • Attached File  doc1.doc (31.5K)
    Number of downloads: 8

Edited by prakruti, 02 July 2009 - 11:23 PM.


#2 MoB

    Enthusiast

  • Active Members
  • PipPip
  • 40 posts

Posted 03 July 2009 - 02:07 AM

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB

#3 mystery

    member

  • Members
  • Pip
  • 3 posts

Posted 08 July 2009 - 07:58 AM

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?


View PostMoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB


#4 MoB

    Enthusiast

  • Active Members
  • PipPip
  • 40 posts

Posted 08 July 2009 - 10:59 PM

It is my observation when performing BSP-PCRs that the PCRs become more specific if the annealing temperature is slightly increased. If you run the PCR at the calculated annealing temp you'll possibly get unspecific amplification. Somebody explained that to me by the lower complexity of the bisulfite converted DNA and therefore the BSP-primers. So if you increase the annealing temp you'll receive only one sharp band. But nevertheless each individual PCR have to be optimized for several parameters like primer-concentrations, annealing temp, MgCl2, etc...!?

Best,

MoB

View Postmystery, on Jul 8 2009, 05:58 PM, said:

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?


View PostMoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB



#5 Christina

    member

  • Members
  • Pip
  • 3 posts

Posted 22 July 2009 - 11:36 PM

View PostMoB, on Jul 8 2009, 10:59 PM, said:

It is my observation when performing BSP-PCRs that the PCRs become more specific if the annealing temperature is slightly increased. If you run the PCR at the calculated annealing temp you'll possibly get unspecific amplification. Somebody explained that to me by the lower complexity of the bisulfite converted DNA and therefore the BSP-primers. So if you increase the annealing temp you'll receive only one sharp band. But nevertheless each individual PCR have to be optimized for several parameters like primer-concentrations, annealing temp, MgCl2, etc...!?

Best,

MoB

View Postmystery, on Jul 8 2009, 05:58 PM, said:

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?


View PostMoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB



touch-down PCR is good,but how could I set the upper temperature and lower temperature?
thanks!





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.