4 replies to this topic

[prakruti]

hi all,

Can anyone please check the BSP primers, I have selected for PCR of my gene. Is the Tm and GC contect alright? I have used meth-primer for designing the primers.

All suggestions and corrections are welcome. and in case my primers are not suitable can anybody help me design the primers.

CCAGTAGAGGGTTATACTTTACTGGGCACAAGTCGTTTATGATAACGAAATTGTAGTTTAATCTGTGAAGAGATGT
GAATGTAACTGAGACACGCTTAAATGGAATATACAGATGAGCTTTATTTTTATATCTGGCATGCTTGGATCCATGCC
GACCCTCCAGCTGCTCGGGCCTGCCCTTAGGGGCTATGGACCGCATGACTCTATCAGCGGCACTGCCACCGCC
GCCGCCTCCGTGCTGCCTGCGTTCCCCGACCATTGATTGGGCCCGGCAGGCGCTTCCTGGGGGCTTCCCT
ACCGGCTCCAGCCCTTGGGATTCGGGAGCGCCCTGCTAGGAAGCCAGAGCCCCGCAGGGGCCGCGGCG
TCCAGGCCGCCTAACGCGCGCCCCTCGCCCGGCGCCCCGAAGCGGCCCCGAGGGGCGGGAGCCGAGG
CGAGCGGCAAGGCCGGGCCGGGGGCGCACAGCGCCCCTAGAAGTGCGGGCTTCCCCCACCCCCGGCA
GCGACCCTACCTCCCGCCCCCGCTGCGTGCGCGCGTGTGTCCGTCTGTCTGTATGCTCTCTCGACGTCAG
TGGGAATTTCCAGCCAGGAAGTGAGAGAGTGAGCGAGACAGAAAGAGAGAGAAGTGCACCAGCGAGCCGGG
GCAGGAAGAGGAGGTTTCGCCACCGGAGCGGCCCGGCGACGCGCTGACAGCTTCCCCTGCCCTTCCCGTCGGTCG
GGCCGCCAGCCGCCGCAGCCCTCGGCCTGCACGCAGCCACCGGCCCCGCTCCCGGAGCCCAGCGCCGCCGAGGC
CGCAGCCGCCCGGCCAGTAAGGCGGCGCCGCCGCCCGGCCACCGCGCGCCCTGCGCTTCCCTCCGCCCGCGCTGC

Primer             Size      Tm        GC%     'C's        Sequence
Left  primer        22     58.71     68.18       6      GGTTTGTTTTTAGGGGTTATGG
Right primer       23     54.28     52.17       5      TTCCTAACTAAAAATTCCCACTA
   Product size: 418, Tm: 73.5, CpGs in product: 47

Note: 'GTG' next to reverse primer is the transcription start site

Attached Files

•  doc1.doc   31.5K   76 downloads

Edited by prakruti, 02 July 2009 - 11:23 PM.

[MoB]

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB

[mystery]

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?

MoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB

[MoB]

It is my observation when performing BSP-PCRs that the PCRs become more specific if the annealing temperature is slightly increased. If you run the PCR at the calculated annealing temp you'll possibly get unspecific amplification. Somebody explained that to me by the lower complexity of the bisulfite converted DNA and therefore the BSP-primers. So if you increase the annealing temp you'll receive only one sharp band. But nevertheless each individual PCR have to be optimized for several parameters like primer-concentrations, annealing temp, MgCl₂, etc...!?

Best,

MoB

mystery, on Jul 8 2009, 05:58 PM, said:

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?

MoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB

[Christina]

MoB, on Jul 8 2009, 10:59 PM, said:

It is my observation when performing BSP-PCRs that the PCRs become more specific if the annealing temperature is slightly increased. If you run the PCR at the calculated annealing temp you'll possibly get unspecific amplification. Somebody explained that to me by the lower complexity of the bisulfite converted DNA and therefore the BSP-primers. So if you increase the annealing temp you'll receive only one sharp band. But nevertheless each individual PCR have to be optimized for several parameters like primer-concentrations, annealing temp, MgCl₂, etc...!?

Best,

MoB

mystery, on Jul 8 2009, 05:58 PM, said:

Hi MoB,
I wonder why to add 5-6C to the calculated annealign temp? Aren't the DNA supposed to anneal at annealing temp?

MoB, on Jul 3 2009, 02:07 AM, said:

Looks good. I calculated a melting temperature of 57,0°C (forward primer) and 56,5°C (reverse-primer). There is a cross-dimer, but nothing to be afraid of. Add 5-6°C to the calculated annealing temeprature when performing your PCR and it should be specific...

Hope that helps...

MoB

touch-down PCR is good,but how could  I set the upper temperature and lower temperature?
thanks!