PCR detection of SNP
Started by where am I?, Jun 18 2009 02:58 AM
6 replies to this topic
#1
Posted 18 June 2009 - 02:58 AM
in the start of my work related to detecting polymorphisms, i've encountered questiion related to primer binding; some papers told that primer binding is releated to sequence similarity @ 3' end of the primer , but other one mentioned even a single nucleotide change in the primer can result in amplification of different DNA and different bands were to be obtained , so i'm in dillema whether primers can detect mutations in primer binding sites , so please help me
#2
Posted 19 June 2009 - 01:41 AM
I am no expert on SNP pcr but from what I understand what counts is the competition. You have both the SNP and the non SNP primer in your mix and let them compete.
Readout can be done in numerable ways IE one primer can be biotinylated and detected with a fluorophore or you can use your sequencer to detect the difference etc.
Readout can be done in numerable ways IE one primer can be biotinylated and detected with a fluorophore or you can use your sequencer to detect the difference etc.
#3
Posted 19 June 2009 - 07:10 PM
If you want to detect SNP, restriction enzyme is more reliable than allele specific PCR. If you want to go for allele-specific PCR, You should put the SNP at the very 3' end of your primer and should have two sets of primers with each complementary to one allele. Before you work on many samples, you should validate the primers and PCR condition by DNA sequencing to make sure there is no false results because such PCR may yield non-specific amplificaiton.
#4
Posted 20 June 2009 - 11:18 PM
thank u for ur advice , but my superviser has already presented 5 primers that bind to strains of actinos and no DNA sequencing is available, i'm getting to the point u mentioned
will u help me in providing links to some study mateerials rrelated to SNP detection by PCR
will u help me in providing links to some study mateerials rrelated to SNP detection by PCR
pcrman, on Jun 19 2009, 08:10 PM, said:
If you want to detect SNP, restriction enzyme is more reliable than allele specific PCR. If you want to go for allele-specific PCR, You should put the SNP at the very 3' end of your primer and should have two sets of primers with each complementary to one allele. Before you work on many samples, you should validate the primers and PCR condition by DNA sequencing to make sure there is no false results because such PCR may yield non-specific amplificaiton.
#5
Posted 21 June 2009 - 01:05 PM
For example you have a DNA sequence with a C/A SNP in it
aacgctagaggcgatacgggatcgatcgaaatcatggcct[c/a]tacgat
You can design a upstream primers for each allele:
primer for C allele:
atacgggatcgatcgaaatcatggcctC
primer for A allele:
atacgggatcgatcgaaatcatggcctA
Then you pick a common downstream primer about 100 bp away from the SNP site. You amplify your DNA sample in two PCRs:
1. C-C-allele specific upstream primer + downstream primer
2. A-allele specific upstream primer + downstream primer
If your sample is homozygotes for C, only C-allele primer gives product, if your sample is C/A heterozygote, both PCRs should give product.
aacgctagaggcgatacgggatcgatcgaaatcatggcct[c/a]tacgat
You can design a upstream primers for each allele:
primer for C allele:
atacgggatcgatcgaaatcatggcctC
primer for A allele:
atacgggatcgatcgaaatcatggcctA
Then you pick a common downstream primer about 100 bp away from the SNP site. You amplify your DNA sample in two PCRs:
1. C-C-allele specific upstream primer + downstream primer
2. A-allele specific upstream primer + downstream primer
If your sample is homozygotes for C, only C-allele primer gives product, if your sample is C/A heterozygote, both PCRs should give product.
#6
Posted 16 July 2009 - 09:58 AM
pcrman, on Jun 21 2009, 10:05 PM, said:
For example you have a DNA sequence with a C/A SNP in it
aacgctagaggcgatacgggatcgatcgaaatcatggcct[c/a]tacgat
You can design a upstream primers for each allele:
primer for C allele:
atacgggatcgatcgaaatcatggcctC
primer for A allele:
atacgggatcgatcgaaatcatggcctA
Then you pick a common downstream primer about 100 bp away from the SNP site. You amplify your DNA sample in two PCRs:
1. C-C-allele specific upstream primer + downstream primer
2. A-allele specific upstream primer + downstream primer
If your sample is homozygotes for C, only C-allele primer gives product, if your sample is C/A heterozygote, both PCRs should give product.
aacgctagaggcgatacgggatcgatcgaaatcatggcct[c/a]tacgat
You can design a upstream primers for each allele:
primer for C allele:
atacgggatcgatcgaaatcatggcctC
primer for A allele:
atacgggatcgatcgaaatcatggcctA
Then you pick a common downstream primer about 100 bp away from the SNP site. You amplify your DNA sample in two PCRs:
1. C-C-allele specific upstream primer + downstream primer
2. A-allele specific upstream primer + downstream primer
If your sample is homozygotes for C, only C-allele primer gives product, if your sample is C/A heterozygote, both PCRs should give product.
hi pcrman,
please correct me if i'm mistaken, but as far as i've seen, a single nucleotide change in a oligo pair, such as C and A in the example you mention,results in a reduction on the product amplification, but you would still get both products, right?
"When there's no more room in hell the dead will walk the Earth"
#7
Posted 17 September 2009 - 03:54 PM
Where Am I - have you considered running real-time PCRs using SNP-specific probes?
The 3' end of the primer is the area which interacts with the template first, so it will naturally be more sensitive to mismatches. But unless you have several mismatches at the 3' end, then you would still get some level of amplification of the alternate template, albeit at a lower efficiency. An LNA primer may help with reducing the numbers of SNP loci needed at the 3' end, so that the primer becomes destabilised enough that it will no longer be able to hybridise with its non-intended target. And remember that purine:pyrimidine changes will be more destabilising than a purine:purine or pyrymidine:pyrimidine change.
The 3' end of the primer is the area which interacts with the template first, so it will naturally be more sensitive to mismatches. But unless you have several mismatches at the 3' end, then you would still get some level of amplification of the alternate template, albeit at a lower efficiency. An LNA primer may help with reducing the numbers of SNP loci needed at the 3' end, so that the primer becomes destabilised enough that it will no longer be able to hybridise with its non-intended target. And remember that purine:pyrimidine changes will be more destabilising than a purine:purine or pyrymidine:pyrimidine change.













