I'm doing a PrP knockout using the siRNA pLKO.1 Cloning Vector which I bought from Addgene. The company is courteous enough by providing us a full scale protocol. There has been no problems with performing the dual digestion of the pLKO.1 by following the protocol, where the 7kb band can be visualized after running the agarose gel.
However, after transformation, there is no colony occurs on the plate. Hence, we suspect there is problem with the oligo annealing and/or the T4 ligation. According to the protocol, oligo is suspended to a concentration of 20uM then the following mixture were created:
5ul Forward oligo
5ul Reverse oligo
5ul 10x NEB buffer2
35ul ddH2O
4mins PCR incubation at 95oC. Then 70oC for 10mins. Cool down oligo to RT over periode of several hours.
Since this protocol didnt produce us with any results, we shift to advanced method using PCR with the following condition:
95oC 5min
95oC (-1C/cycle) 1min 35cycle
60oC 30mins
60oC (-1C/cycle) 1min 25cycle
4oC Hold
Sadly, there's no successful annealing as well. We have even try out the water bath condition by incubation at 95oC for 10mins and let it cool down to RT.
Below is the information regarding our primers:
Forward Primer (5’-3’)
HuPrPRNAi1: CCGGAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATTTTTTTG
HuPrPRNAi2: CCGGAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTTTTTTTG
Reverse Primer (5’-3’)
HuPrPRNAi1: AATTCAAAAAAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATT
HuPrPRNAi2: AATTCAAAAAAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTT
For your information, I have two pairs of primers with melting temperature around 60oC.
Anyone have any suggestions on this? By the way, how could one determine the successful of oligo annealing? Thanks thanks for any feedback.
Edited by yean_ny_nie, 26 May 2009 - 03:44 AM.
















