Jump to content

  • Log in with Facebook Log in with Twitter Log In with Google      Sign In   
  • Create Account

olligo annealing for shRNA cloning


  • Please log in to reply
20 replies to this topic

#1 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 25 May 2009 - 10:52 PM

Hi,

I'm doing a PrP knockout using the siRNA pLKO.1 Cloning Vector which I bought from Addgene. The company is courteous enough by providing us a full scale protocol. There has been no problems with performing the dual digestion of the pLKO.1 by following the protocol, where the 7kb band can be visualized after running the agarose gel.

However, after transformation, there is no colony occurs on the plate. Hence, we suspect there is problem with the oligo annealing and/or the T4 ligation. According to the protocol, oligo is suspended to a concentration of 20uM then the following mixture were created:
5ul Forward oligo
5ul Reverse oligo
5ul 10x NEB buffer2
35ul ddH2O

4mins PCR incubation at 95oC. Then 70oC for 10mins. Cool down oligo to RT over periode of several hours.

Since this protocol didnt produce us with any results, we shift to advanced method using PCR with the following condition:
95oC                                    5min
95oC (-1C/cycle)                   1min                35cycle
60oC                                    30mins
60oC (-1C/cycle)                   1min                25cycle
4oC                                      Hold
Sadly, there's no successful annealing as well. We have even try out the water bath condition by incubation at 95oC for 10mins and let it cool down to RT.

Below is the information regarding our primers:
Forward Primer (5’-3’)
HuPrPRNAi1: CCGGAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATTTTTTTG
HuPrPRNAi2: CCGGAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTTTTTTTG

Reverse Primer (5’-3’)
HuPrPRNAi1: AATTCAAAAAAATGCCCTATCTTAGTAGAGACTCGAGTCTCTACTAAGATAGGGCATT
HuPrPRNAi2: AATTCAAAAAAAGGCAAATCTCCTTTGTCCACTCGAGTGGACAAAGGAGATTTGCCTT

For your information, I have two pairs of primers with melting temperature around 60oC.

Anyone have any suggestions on this? By the way, how could one determine the successful of oligo annealing? Thanks thanks for any feedback.  :(

Edited by yean_ny_nie, 26 May 2009 - 03:44 AM.


#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,015 posts
43
Excellent

Posted 26 May 2009 - 10:24 PM

Hi,

Oligo cloning is straight forward with high success rates.

When doing oligo annealing, you don't need to use a PCR machine and a complicated program. I just heat a big beaker of water to 94 degree and throw the mixture in the water to allow the water to gradully cool down to 37C and then maintain at 37C for one hour. After annealing, run an agarose gel to check if there is ds-oligo by running ss-oligo and the annealed oligos side by side.

Make sure both enzymes cut the vector. Set up a reaction with just one enzyme added.

After ligation, run a gel with 4-5 ul of ligation reaction to see if the ligation is successful or not.

Did you get colonies from positive transformation? I hope you have included it.

My experience is: Check every step (which you can) before proceed to the next step.

Good luck!

#3 Bomber

Bomber

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 52 posts
0
Neutral

Posted 26 May 2009 - 11:15 PM

Hi,

agree with pcrman. oligo annealing should not be the problem. i also basically follow the procedure of pcrman. heat mixture to 95°C for 1min, and further incubate for 1hrs at 37°C.
after this check the annealing on an agarose gel.
was it necessary to resuspend your oligos? If so, you might also measure this in a uv spec. to make sure you work with the concentrations suggested.
i recently used the cloning strategy from ambion (pSilencer manual) maybe it's worth taking a look into the manual and follow their procedures. for me, this worked very efficient.

good luck

Edited by Bomber, 26 May 2009 - 11:18 PM.


#4 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,015 posts
43
Excellent

Posted 27 May 2009 - 06:17 AM

I agree with Bomber, Ambion's protocol works great.

#5 Functional Screens

Functional Screens

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 118 posts
4
Neutral

Posted 27 May 2009 - 06:09 PM

I guess you use too much vector and annealed oligos.  Sometimes, more is not better.

Here is the link I download the protocol, it works very well to me.
http://biosettia.com...-rnai/protocols

1. In a 1.5 ml microcentrifuge tube, set up the annealing reaction in total 20 μl mixture as following:
    10 μl   100 uM single-strand oligo
    2 μl    10× annealing buffer
    8 μl    distilled water

2. Incubate the DNA oligo at 95°C for 5 minutes (water bath is better than heat block).

3. Remove the tube from the water bath and allow the reaction mixture to cool to room temperature for 10 minutes.

4. Dilute 1 μl annealed double-strand oligo in 499 μl distilled water, vortex for 5sec.

Optional: Load 20 μl of diluted oligo onto 4% agarose gel (FMC Bioproducts, NuSieve GTG Agarose Catalog No. 50082) to determine annealing efficiency.

5. Mix 1 μl (25 ng) pLV-RNAi vector with 2 μl 500× diluted (50 nM final) double-strand oligo for ligation reaction (20 μl in total).

For lentiviral vector, please use DH5a or Stbl3 competent cells to prevent recombination.  Other bacterial strains such as TOP10 and XL-1 will give you a lot of problems.  
You should get hundreds of colonies when you transform 3-5 μl ligation mix from above.

#6 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 28 May 2009 - 04:39 PM

Thanks for all the suggestions. I'll try to make up with it.  :huh:

#7 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 03 June 2009 - 05:39 PM

Dear all,

I have run a 4% agarose gel to determine for annealing succession, however both my primers and "annealed oligos" also showed two bands. What could be this means? Anyone have any suggestions regarding to this?

I have attached the gel picture as below. The first lane from the left would be my primer before annealing and the second and third lane from the left would be the oligo after annealing. Thanks for you feedback in advance.

Attached Thumbnails

  • 1st_june_annealing_oligo.jpg


#8 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,015 posts
43
Excellent

Posted 03 June 2009 - 08:38 PM

You did not include DNA marker in your gel picture. It is hard to tell the size of the bands. I previously had a nice gel picture but could not find it any more. In stead I found one on Invitrogen site. It serves the purpose well.  
Posted Image

After annealing, the dsDNA will definitely show up as a higher band than the ssDNA. In addition, you don't need to use that high (4%) concentration gel, 2% is enough.

#9 Bomber

Bomber

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 52 posts
0
Neutral

Posted 04 June 2009 - 06:01 AM

Hmmm,

that looks weird.
One thing you might check, is the purity of your primers. In case you have a lot of degradation products left in your synthesized oligos it might hamper effective annealing.

#10 Functional Screens

Functional Screens

    Veteran

  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 118 posts
4
Neutral

Posted 04 June 2009 - 05:33 PM

My suggestion is just go ahead to do cloning to see whether you can get the right clone.

Attached Thumbnails

  • annealing.jpg


#11 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 04 June 2009 - 06:03 PM

View PostBomber, on Jun 4 2009, 10:01 PM, said:

Hmmm,

that looks weird.
One thing you might check, is the purity of your primers. In case you have a lot of degradation products left in your synthesized oligos it might hamper effective annealing.

Hi Bomber,

How can I check the purity of my primers? Thank you.

#12 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 04 June 2009 - 06:05 PM

View PostFunctional Screens, on Jun 5 2009, 09:33 AM, said:

My suggestion is just go ahead to do cloning to see whether you can get the right clone.

Hi Functinal Screens,
I didn't do any cloning but I indeed procceed to transformation, however, there's no colony observed though.

#13 Bomber

Bomber

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 52 posts
0
Neutral

Posted 05 June 2009 - 12:27 AM

Well, when I ordered oligos for shRNA cloning the company where we ususally order primers suggested to have the oligos rather well purified; higher than any standard primer we usually order, since otherwise a lot of degradation products remain in the reaction.
This is also stated in the Ambion manual for shRNA cloning, so it seems to be critical point.
I don't know if this relevant but maybe this is why annelaing is hampered in your reaction. Though it is strange that you do not obtain any colonies.
Are you certain that your double digest works fine? I assume the restriction sites are in close proximity?
Have you succesfully cloned anything else successfully into the plasmid, like a negative control shRNA?

#14 stardust

stardust

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 60 posts
0
Neutral

Posted 05 June 2009 - 04:33 AM

Hi,

I used the following protocol with good results:

Dilute oligo to 1µg/µl. 1 µl top oligo + 1 µl bottom oligo + 2 µl annealing buffer (10 x buffer: 100 mM Tris pH8,5; 1 M NaCl; 10 mM EDTA) + 16 µl ddH2O. Heat for 5 min in PCR cycler to 95°C. switch of and let cool to room temperature for 3 hours. use 2 µl of the annealing mix and ligate with 100 ng digested vector in 20 µl reaction volume over night. Electroporate 1 µl of the mixture in DH10B cells and plate.

To check annealing I usually run 1 µl of the annealing mix on a 3 % gel. I also often get 2 bands in the unannealed oligo control but it still works if the upper band in annealed oligo is stronger than in the untreated oligo.

Stardust

#15 yean_ny_nie

yean_ny_nie

    member

  • Active Members
  • Pip
  • 25 posts
1
Neutral

Posted 07 June 2009 - 06:35 PM

View PostBomber, on Jun 5 2009, 04:27 PM, said:

Well, when I ordered oligos for shRNA cloning the company where we ususally order primers suggested to have the oligos rather well purified; higher than any standard primer we usually order, since otherwise a lot of degradation products remain in the reaction.
This is also stated in the Ambion manual for shRNA cloning, so it seems to be critical point.
I don't know if this relevant but maybe this is why annelaing is hampered in your reaction. Though it is strange that you do not obtain any colonies.
Are you certain that your double digest works fine? I assume the restriction sites are in close proximity?
Have you succesfully cloned anything else successfully into the plasmid, like a negative control shRNA?

I assume that my dual digestion for the cloning vector works well as we indeed saw the desired band as suggested by the protocol after running the gel. However, I've repeating the dual digestion again today. Hopefully it will yields some results. For the time being, we didn't do other cloning besides this one.

Thanks for your help a lot.  :rolleyes:




Home - About - Terms of Service - Privacy - Contact Us

©1999-2012 Protocol Online, All rights reserved.