Warning: mb_substr_count() expects at most 3 parameters, 4 given in /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php on line 1269

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 110

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 127

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 136

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 137

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 141
CHIP primers - DNA Methylation and Epigenetics - BioForum

Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

CHIP primers

  • Please log in to reply
6 replies to this topic

#1 Raviraj



  • Members
  • Pip
  • 4 posts

Posted 12 May 2009 - 09:23 PM

Dear all,

I have to do some CHIP QPCRs to check the Histone acetylation. I am not familiar with the primer design on the promoter region. As far as I know, primer design is a crucial part on the CHIP QPCR. Could any one please help me on primer design?

Gene-rat ROCK1
Accession no-NM 031098.1

#2 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 13 May 2009 - 03:08 AM

Here you go.

A 500 bp promoter sequence (very CpG rich)
Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
Hope that works

#3 Raviraj



  • Members
  • Pip
  • 4 posts

Posted 13 May 2009 - 05:30 PM

Thanks a lot pcrman :D

#4 mura



  • Members
  • Pip
  • 4 posts

Posted 19 May 2009 - 09:53 AM

Hi Pcrman,

What software did you use for designing these primers?


Here you go.

A 500 bp promoter sequence (very CpG rich)

Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
Hope that works

Edited by mura, 19 May 2009 - 09:57 AM.

#5 pcrman



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts

Posted 19 May 2009 - 12:09 PM

The primers were designed using Primer3. You can use any program to design ChIP primers. The important thing is that you need to decide which region of your gene you want to examine.

#6 giny



  • Active Members
  • Pip
  • 15 posts

Posted 27 July 2009 - 02:01 AM

Hi pcrman, how do i determine which region is the promoter sequence from the sequence I obtained from fasta format?

#7 epigenetics



  • Active Members
  • PipPipPipPipPip
  • 68 posts

Posted 27 July 2009 - 06:07 AM

would you please let us know how did you determine the promoter region. and can i use Primer Express from ABI to generate CHIP primers?
There is one databse in the following link. Is this good?

Here you go.

A 500 bp promoter sequence (very CpG rich)

Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
Hope that works

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.