Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
Photo
- - - - -

CHIP primers


  • Please log in to reply
6 replies to this topic

#1 Raviraj

Raviraj

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 12 May 2009 - 09:23 PM

Dear all,

I have to do some CHIP QPCRs to check the Histone acetylation. I am not familiar with the primer design on the promoter region. As far as I know, primer design is a crucial part on the CHIP QPCR. Could any one please help me on primer design?

Gene-rat ROCK1
Accession no-NM 031098.1

#2 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 13 May 2009 - 03:08 AM

Here you go.

A 500 bp promoter sequence (very CpG rich)
AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC
Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100
Hope that works

#3 Raviraj

Raviraj

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 13 May 2009 - 05:30 PM

Thanks a lot pcrman :D

#4 mura

mura

    member

  • Members
  • Pip
  • 4 posts
0
Neutral

Posted 19 May 2009 - 09:53 AM

Hi Pcrman,

What software did you use for designing these primers?
Thanks

Mura

Here you go.

A 500 bp promoter sequence (very CpG rich)

AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC
Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100
Hope that works


Edited by mura, 19 May 2009 - 09:57 AM.


#5 pcrman

pcrman

    Epigenetist

  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 1,165 posts
67
Excellent

Posted 19 May 2009 - 12:09 PM

The primers were designed using Primer3. You can use any program to design ChIP primers. The important thing is that you need to decide which region of your gene you want to examine.

#6 giny

giny

    member

  • Active Members
  • Pip
  • 15 posts
0
Neutral

Posted 27 July 2009 - 02:01 AM

Hi pcrman, how do i determine which region is the promoter sequence from the sequence I obtained from fasta format?

#7 epigenetics

epigenetics

    Enthusiast

  • Active Members
  • PipPipPipPipPip
  • 68 posts
0
Neutral

Posted 27 July 2009 - 06:07 AM

would you please let us know how did you determine the promoter region. and can i use Primer Express from ABI to generate CHIP primers?
There is one databse in the following link. Is this good?
http://rulai.cshl.ed...=searchPromForm
Thanks


Here you go.

A 500 bp promoter sequence (very CpG rich)

AAAATGGGAGAGTGAGCCTGTTCTGTGGAAACCAGCTCTTGGCCGAGGATAAATCAGTGC
GTCTTACCGGGCCGAGTGGAACCCGGGATGCAGGGCTAGACAGCCGCTAGCGCCTTAGAG
CGGAGCGGGGCCGGCCCGGGGCCCAGGCGGCAGCTGGCGCAGCTCCTCACCCGCCCTTCG
CTTTCGCCTTTCCTCTTCGCCCTCCCTGGCTGCCCCGAGGGAGTCTCCACCCTGCTGCGC
TCCCTCTTCCCGCCGCTGCCCTTCTCTGGACTGGGCCCCGCCATGGCGAAGGCAGCCGGG
GCCCGCTAGGCTGAGGTGCCTCGCCGGAGCGACCGGGCTGCTGGCGACGGCGCTGTCGGC
TGTCGCGAGGGGCTGCCGGGTGGGATGCGACTTTGGGTGTCCGAGCGGCTGCGGGTCGCT
GTCACCCCCAGCCTGGGGTCTAGAGAGCAGAGGTCCCCTCAGTGAGGGGAAGGAGGGGGA
ACCGGGCGCACCTGGTGACC
Two sets of ChIP primers on the promoter:
LEFT PRIMER		  5   20   59.99   55.00  3.00  1.00 11.00 TGGGAGAGTGAGCCTGTTCT
RIGHT PRIMER	   104   19   60.93   63.16  4.00  2.00 10.00 GCTGTCTAGCCCTGCATCC
PRODUCT SIZE: 100

LEFT PRIMER		378   18   62.49   61.11  4.00  0.00  9.00 GGGTGGGATGCGACTTTG
RIGHT PRIMER	   477   18   60.60   66.67  3.00  3.00 11.00 CCCTCCTTCCCCTCACTG
PRODUCT SIZE: 100
Hope that works






Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.