4 replies to this topic

[BGS]

Hi!

I have a question about the short sequences that enable homologous recombination ;
How many base pair do these sequences need to be long and how homologous they need to be to enable homologous recombination?
Could the pairing of the sequences like the examples below enable homologous recombination?

Identities = 25/31 (80%), Gaps = 0/31 (0%)

TAGAACCTGTTAAAAATATAATCCACAATTC
|| ||| | ||||||||||||| | |||||
TAAAACATCTTAAAAATATAATAAATAATTC

Identities = 22/26 (84%), Gaps = 0/26 (0%)

CTAAAAATTTATTTTAAATAATCTTA
|||||||||||| | ||||| ||||
CTAAAAATTTATCTAAAATATCCTTA

Identities = 19/21 (90%), Gaps = 0/21 (0%)

ATATCTTTTGAAGATATCTCA
|| |||||||||||||| |||
ATGTCTTTTGAAGATATATCA

Identities = 16/16 (100%), Gaps = 0/16 (0%)

TAGATGATTTAATAGA
||||||||||||||||
TAGATGATTTAATAGA

[bob1]

BGS, on May 6 2009, 07:27 AM, said:

Hi!

I have a question about the short sequences that enable homologous recombination ;
How many base pair do these sequences need to be long and how homologous they need to be to enable homologous recombination?
Could the pairing of the sequences like the examples below enable homologous recombination?

Identities = 25/31 (80%), Gaps = 0/31 (0%)

TAGAACCTGTTAAAAATATAATCCACAATTC
|| ||| | ||||||||||||| | |||||
TAAAACATCTTAAAAATATAATAAATAATTC

Identities = 22/26 (84%), Gaps = 0/26 (0%)

CTAAAAATTTATTTTAAATAATCTTA
|||||||||||| | ||||| ||||
CTAAAAATTTATCTAAAATATCCTTA

Identities = 19/21 (90%), Gaps = 0/21 (0%)

ATATCTTTTGAAGATATCTCA
|| |||||||||||||| |||
ATGTCTTTTGAAGATATATCA

Identities = 16/16 (100%), Gaps = 0/16 (0%)

TAGATGATTTAATAGA
||||||||||||||||
TAGATGATTTAATAGA

To me this looks a lot like homework.... in which case you are in the wrong subforum. However, you don't need 100% homologous pairing, but I don't know the limits in length or similarity of sequence before it is affected.

[BGS]

I agree it looks like homework, and I wish it was… Maybe I am also in a wrong subforum and in this case I would appreciate a comment as well.
Let me explain my question a bit;
In the organism that I study, I can see large genetic rearrangements of the genome in the region of pathogenicity genes and adjacent region. My theory is that this is due to homologous recombination. I can find short somewhat similar sequences in the genomes of different strains. Could these be responsible for the genetic rearrangement? How long (in bp) and how homologous do sequences need to be to enable homologous recombination?
Many thanks for any comment!

[WHR]

BGS, on May 6 2009, 06:27 AM, said:

I have a question about the short sequences that enable homologous recombination ;
How many base pair do these sequences need to be long and how homologous they need to be to enable homologous recombination?

Homologous recombination is very efficient in yeast. We usually use 45 bp homology at both end for gene replacement.

Edited by WHR, 07 May 2009 - 03:27 AM.

[perneseblue]

it depends on the species.

For yeast (S.pombe), the homologous recombination is very efficient. As few as 25 bp and you can have significant rates of recombination. 80bp is enough for efficient gene targeting.

Homologous recombination does not need full sequence identity but works significantly better when present.