wrong gene
#1
Posted 11 April 2009 - 03:09 AM
well, the primers used was those that already established by researchers.
first time direct sequencing i got noisy background,
so i turn to cloning the PCR product into pGEMT-easy vecotr, and send for sequencing. (PCR had been done onto plasmid extracted after transformation, and the insert size is confirmed at desired size)
however, i was shocked that when i got the sequencing result.
it dint show any relates to the reductase enzymes, and it show high homology to some sort of other enzyme in chromosomal region.
well, i get the desired PCR size, i suppose it's the gene i desired, but now it turn out to be wrong.
anyone could give me a hand onto this ?
even if it's explainable by the possibilities of existence of homology priming site, but it would throw a contradiction coz the primer is a well-established one. primer design is not questionable in this case i think...
=(
#2
Posted 11 April 2009 - 10:05 PM
What do you mean by "primers are well established".....are these universal primers to some conserved regions in reductases or they pertain to yr target gene in a specific organism only.
If they are universal, what is the problem in using gene specific and organism specific primers?
If u have the gene sequence, no harm in checking the primers once
Best,
TC
#3
Posted 11 April 2009 - 10:17 PM
#4
Posted 12 April 2009 - 01:57 AM
In that case maybe you can check yr PCR product by restriction digestion before you go for cloning it. In this case you would atleast know whether ou are cloning the right gene or not.
Otherwise just go for gene specific primers.
Best,
TC
#5
Posted 12 April 2009 - 02:02 AM
by the way, is there any reason behind all this ? that although gene is amplified at desired size and yet it's the wrong amplicon ?
#6
Posted 12 April 2009 - 11:22 AM
I am not sure...its very rare that you get the right size in PCR, clone it and find it to be something else....if this is really happening, my take would be that you picked up a junk colony.
Thus I would put a chk at every stage and check, the first one would be what I suggested...... digest the PCR product and make sure that amplification is okay.
But this universal primers for reductases is new to me.....I know people working on reductases and they use gene specific primers. Can u send me the paper where universal primers are used. I will get a chance to show off that I know more on reductases than that person workign on it.
All the best,
TC
tyrael, on Apr 12 2009, 04:32 PM, said:
by the way, is there any reason behind all this ? that although gene is amplified at desired size and yet it's the wrong amplicon ?
#7
Posted 13 April 2009 - 04:09 AM
since u use pGEM i assuming u are doing TOPO cloning.
if the seq is same as the primers u used to PCR . then we will buy the Homology theory.
doing this could help to rule out using the "wrong" primers for PCR.
#8
Posted 13 April 2009 - 05:10 AM
1. i am dealing with mercury reductase (encoded by merA gene).
2. yes, i am doing TOPO TA Cloning -- cloning the PCR product directly into pGEMT-Easy vector.
3. wat do u mean by "if the seq is same as the primers u used to PCR" ? ok, i have cloned it into pGEMT-easy vector, and sequence it by using SP6 and T7 primer.
and the sequencing result = after the T7 primer sequence, it's followed by my PCR primer sequence. pls correct me if i interpret ur sentence wrongly.
4. hope to hear from u soon. thank you.
#9
Posted 13 April 2009 - 06:31 PM
does the chromosoally encoded gene share high homology especially in term of conserved region in the merA gene?
#10
Posted 13 April 2009 - 06:53 PM
but the bacteria that i worked on is not one of them, raising me two possibilities:
1. my bacteria it did have the conserved region as like others, but the homology theory is overwhelming.
2. my bacteria it is distinct different from the conserved region.
wat do u think ?
#11
Posted 14 April 2009 - 02:14 AM
what gene is the most similar to urs?
if u could translate it into protein that would be even better.
do an ORF find and then blast
Edited by hanming86, 14 April 2009 - 02:15 AM.
#12
Posted 14 April 2009 - 04:02 AM
highest similarity: 82% - Enterobacter sp. polysaccharide deacetylase domain protein
my working bacteria is Klebsiella pneumoniae. so if i choose K. pneumoniae
similarity: 77% - Klebsiella pneumoniae 342 - polysaccharide deacetylase domain protein
for ur reference, i paste my sequence result here (FASTA format):
>TrC-G-2-T7
NNNTNNCNAGTCCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATTACCATCGGCG
GCACCTGCGTTACCCCATTCTGAATAAGCTCAAAGACCGTCTGAATCAGACGTGGTATCA
AATCCGCATTGGCAATCGCCTGGCGTGGATCAGCAGCCTGGATGCGCAGGAAGATAACGG
CATCCCGGTTCTCACCTACCACCATATTCTGCGCGACGAAGAAAACACCCGTTTTCGCCA
TACCTCCACGACCACCAGCGTACGTGCGTTCAGCAACCAGATGACCTGGCTTCGCGATCA
GGGATACGCCACGCTGACGATGTACCAGCTGGAAGGCTACGTGCGTAACAAGATGAACCT
GCCCGCGAAGGCGGTGGTGATTACGTTTGACGATGGGCTGAAGTCGGTGAGCCGTTACGC
TTACCCGGTTCTGAAAGAATATGGCTTCAACGCGACGGCGTTTATCATTTCGTCACGCAT
CAAAGGTCATCCGCAGAAGTGGGACCCAAAATCGCTGCAGTTTATGAGCGTTCAGGAAAT
TAAGGGCATACAGGACGTGTTCGACATTCAGTCTCACACTCACTTCCTGCATCGCGTGGA
TGGGTATAAACACCCGATTTTATTGAGCCGCAGCTATCACGTGATCCTGTTCGATTTTGA
ACGTTCCCGCCGTGCGCTGTCGCAGTTCAACCCGCGCGTGCTGTACCTTTCTTACCCGTT
TGGCGGCTATGACAATAAAGCGATCAAGGCAGCGAACGACGCCGGTTTTCATCTGGCGGT
AACGACGGTGAAAGGGAAGGTCAAGCCGGGGGATAATCCGTTCTTACTGAAACGCCTCTA
TATCTTAAGAACGGATTCGCTGGAGACGATGTCGCGGCTGATCAGCAATCAGCCGCAGGG
GTAGGATTAATTGTAGGAGATGGTGAACACGCCGGAAGCGCTAAACGCGCCGGGGGTAAT
CATGCTGCCATCTGCGATCAGTTGGGCCACAAAGTTATCTGCGTCGACGTGGGACACTGT
TTCGTCATGTCATACGACGAGTCGCATCATGGGATAGCTGCAGTCCCGTGTATACAGATC
TCACGCCCGNACTGCGCCCTGTGANCGTATCGCNANAGTCATGNCTATNCCGTCANNNNN
TCTGANCTATGNATATCNNCCNCGCAGNGCCGCCNATGTATCNCT
#13
Posted 14 April 2009 - 05:25 AM
we are close to solving ur puzzle
#14
Posted 14 April 2009 - 06:38 AM
(Forward)
Primer A5 ACCATCGTCAGGTAGGGGACCAA 23-mer
(Reverse)
EXPECTED SIZE = 1238bp
here by i attach u the journal published.
Attached File(s)
-
1.Phylogeny_of_Mercury_Resistance__mer__Operons_of_Gram_Negative.pdf (1.03MB)
Number of downloads: 0 -
2.Functional_profiling_of_mercuric_reductase__mer_A__genes_in_biofilm_communities_of_a_technical_scale_biocatalyzer.pdf (615.77K)
Number of downloads: 0














