Jump to content


- - - - -

wrong gene


13 replies to this topic

#1 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 11 April 2009 - 03:09 AM

my work was about isolating out a reductase enzyme from a bacteria by PCR screening.
well, the primers used was those that already established by researchers.

first time direct sequencing i got noisy background,
so i turn to cloning the PCR product into pGEMT-easy vecotr, and send for sequencing. (PCR had been done onto plasmid extracted after transformation, and the insert size is confirmed at desired size)

however, i was shocked that when i got the sequencing result.
it dint show any relates to the reductase enzymes, and it show high homology to some sort of other enzyme in chromosomal region.

well, i get the desired PCR size, i suppose it's the gene i desired, but now it turn out to be wrong.
anyone could give me a hand onto this ?

even if it's explainable by the possibilities of existence of homology priming site, but it would throw a contradiction coz the primer is a well-established one. primer design is not questionable in this case i think...

=(

#2 T C

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 280 posts

Posted 11 April 2009 - 10:05 PM

Hey,

What do you mean by "primers are well established".....are these universal primers to some conserved regions in reductases or they pertain to yr target gene in a specific organism only.

If they are universal, what is the problem in using gene specific and organism specific primers?

If u have the gene sequence, no harm in checking the primers once
Best,
TC

#3 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 11 April 2009 - 10:17 PM

the primers were aligned based on 30 kinds of bacteria flanking the conserve regions of that reductase gene; and it has been widely used by many researchers in related field. so i think it can be considered as well established kind ?

#4 T C

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 280 posts

Posted 12 April 2009 - 01:57 AM

Hi,

In that case maybe you can check yr PCR product by restriction digestion before you go for cloning it. In this case you would atleast know whether ou are cloning the right gene or not.

Otherwise just go for gene specific primers.


Best,

TC

#5 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 12 April 2009 - 02:02 AM

alrite Thank you TC. :D

by the way, is there any reason behind all this ? that although gene is amplified at desired size and yet it's the wrong amplicon ?

#6 T C

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 280 posts

Posted 12 April 2009 - 11:22 AM

Hey,

I am not sure...its very rare that you get the right size in PCR, clone it and find it to be something else....if this is really happening, my take would be that you picked up a junk colony.

Thus I would put a chk at every stage and check, the first one would be what I suggested...... digest the PCR product and make sure that amplification is okay.

But this universal primers for reductases is new to me.....I know people working on reductases and they use gene specific primers. Can u send me the paper where universal primers are used. I will get a chance to show off that I know more on reductases than that person workign on it. :))

All the best,

TC

View Posttyrael, on Apr 12 2009, 04:32 PM, said:

alrite Thank you TC. :D

by the way, is there any reason behind all this ? that although gene is amplified at desired size and yet it's the wrong amplicon ?


#7 hanming86

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 159 posts

Posted 13 April 2009 - 04:09 AM

Can u tell specifically what gene that is. and what u can try is sequence out of the gene instead of inside. then u would be able to go until the primer site.

since u use pGEM i assuming u are doing TOPO cloning.

if the seq is same as the primers u used to PCR . then we will buy the Homology theory.

doing this could help to rule out using the "wrong" primers for PCR.
Lab + Coffee + Music = Bliss

#8 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 13 April 2009 - 05:10 AM

Hi Hanming.

1. i am dealing with mercury reductase (encoded by merA gene).

2. yes, i am doing TOPO TA Cloning -- cloning the PCR product directly into pGEMT-Easy vector.

3. wat do u mean by "if the seq is same as the primers u used to PCR" ? ok, i have cloned it into pGEMT-easy vector, and sequence it by using SP6 and T7 primer.
and the sequencing result = after the T7 primer sequence, it's followed by my PCR primer sequence. pls correct me if i interpret ur sentence wrongly.

4. hope to hear from u soon. thank you.

#9 hanming86

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 159 posts

Posted 13 April 2009 - 06:31 PM

so we gonna buy the homology theory assuming that the seq result u obtained also included the seq of the primers u used to amplify ur gene.

does the chromosoally encoded gene share high homology especially in term of conserved region in the merA gene?
Lab + Coffee + Music = Bliss

#10 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 13 April 2009 - 06:53 PM

ya.. that's the thing that i need to figure it out now.. though the primer design is based on alignment of 30 gram-negative bacteria,
but the bacteria that i worked on is not one of them, raising me two possibilities:

1. my bacteria it did have the conserved region as like others, but the homology theory is overwhelming.

2. my bacteria it is distinct different from the conserved region.


wat do u think ?

#11 hanming86

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 159 posts

Posted 14 April 2009 - 02:14 AM

give it a blast and what did u get?

what gene is the most similar to urs?

if u could translate it into protein that would be even better.

do an ORF find and then blast

Edited by hanming86, 14 April 2009 - 02:15 AM.

Lab + Coffee + Music = Bliss

#12 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 14 April 2009 - 04:02 AM

blast result:
highest similarity: 82% - Enterobacter sp. polysaccharide deacetylase domain protein


my working bacteria is Klebsiella pneumoniae. so if i choose K. pneumoniae

similarity: 77% - Klebsiella pneumoniae 342 - polysaccharide deacetylase domain protein



for ur reference, i paste my sequence result here (FASTA format):

>TrC-G-2-T7
NNNTNNCNAGTCCATGCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATTACCATCGGCG
GCACCTGCGTTACCCCATTCTGAATAAGCTCAAAGACCGTCTGAATCAGACGTGGTATCA
AATCCGCATTGGCAATCGCCTGGCGTGGATCAGCAGCCTGGATGCGCAGGAAGATAACGG
CATCCCGGTTCTCACCTACCACCATATTCTGCGCGACGAAGAAAACACCCGTTTTCGCCA
TACCTCCACGACCACCAGCGTACGTGCGTTCAGCAACCAGATGACCTGGCTTCGCGATCA
GGGATACGCCACGCTGACGATGTACCAGCTGGAAGGCTACGTGCGTAACAAGATGAACCT
GCCCGCGAAGGCGGTGGTGATTACGTTTGACGATGGGCTGAAGTCGGTGAGCCGTTACGC
TTACCCGGTTCTGAAAGAATATGGCTTCAACGCGACGGCGTTTATCATTTCGTCACGCAT
CAAAGGTCATCCGCAGAAGTGGGACCCAAAATCGCTGCAGTTTATGAGCGTTCAGGAAAT
TAAGGGCATACAGGACGTGTTCGACATTCAGTCTCACACTCACTTCCTGCATCGCGTGGA
TGGGTATAAACACCCGATTTTATTGAGCCGCAGCTATCACGTGATCCTGTTCGATTTTGA
ACGTTCCCGCCGTGCGCTGTCGCAGTTCAACCCGCGCGTGCTGTACCTTTCTTACCCGTT
TGGCGGCTATGACAATAAAGCGATCAAGGCAGCGAACGACGCCGGTTTTCATCTGGCGGT
AACGACGGTGAAAGGGAAGGTCAAGCCGGGGGATAATCCGTTCTTACTGAAACGCCTCTA
TATCTTAAGAACGGATTCGCTGGAGACGATGTCGCGGCTGATCAGCAATCAGCCGCAGGG
GTAGGATTAATTGTAGGAGATGGTGAACACGCCGGAAGCGCTAAACGCGCCGGGGGTAAT
CATGCTGCCATCTGCGATCAGTTGGGCCACAAAGTTATCTGCGTCGACGTGGGACACTGT
TTCGTCATGTCATACGACGAGTCGCATCATGGGATAGCTGCAGTCCCGTGTATACAGATC
TCACGCCCGNACTGCGCCCTGTGANCGTATCGCNANAGTCATGNCTATNCCGTCANNNNN
TCTGANCTATGNATATCNNCCNCGCAGNGCCGCCNATGTATCNCT

#13 hanming86

    Veteran

  • Active Members
  • PipPipPipPipPip
  • 159 posts

Posted 14 April 2009 - 05:25 AM

the seq of primers that u used to amplify the gene and the paper associated with it. attach it.

we are close to solving ur puzzle
Lab + Coffee + Music = Bliss

#14 tyrael

    Enthusiast

  • Active Members
  • PipPip
  • 23 posts

Posted 14 April 2009 - 06:38 AM

Primer A1 ACCATCGGCGGCACCTGCGT 20-mer
(Forward)

Primer A5 ACCATCGTCAGGTAGGGGACCAA 23-mer
(Reverse)

EXPECTED SIZE = 1238bp


here by i attach u the journal published.





Home - About - Terms of Service - Privacy - Contact Us

©1999-2011 Protocol Online, All rights reserved.