Warning: mb_substr_count() expects at most 3 parameters, 4 given in /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php on line 1269

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 110

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 127

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 136

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 137

Warning: Cannot modify header information - headers already sent by (output started at /home/protocol/public_html/forums/admin/sources/classes/text/parser/bbcode/defaults.php:1269) in /home/protocol/public_html/forums/admin/sources/classes/output/formats/html/htmlOutput.php on line 141
Restriction site - Molecular Cloning - BioForum

Jump to content

  • Log in with Facebook Log in with Twitter Log in with Windows Live Log In with Google      Sign In   
  • Create Account

Submit your paper to J Biol Methods today!
- - - - -

Restriction site

  • Please log in to reply
4 replies to this topic

#1 leyhian83



  • Members
  • Pip
  • 3 posts

Posted 28 March 2009 - 03:15 PM

Dear all expert,

I would like to ask you guys about restriction site.

If I had design a primer for Insert PCR,

With forward primer of AGATCTATGGCGTTGGCGTTG (underline is BglII digestion site)

Notice that I made a mistake and it should be gtAGATCTATGGCGTTGGCGTTG and providing more space for the BglII to hang on it. I wonder whether the enzyme will still do its digestion as the amplicon might not have enough space to hang onto the DNA.

Please give me guidance and advices about this.


Edited by leyhian83, 28 March 2009 - 03:16 PM.

#2 HomeBrew



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts

Posted 28 March 2009 - 06:08 PM

According to NEB's chart, there's no digestion by BglII without at least a two-base overhang.

#3 T C



  • Active Members
  • PipPipPipPipPipPipPipPipPipPip
  • 277 posts

Posted 28 March 2009 - 07:07 PM


Not sure if it would cut or not but you can always do the PCR with pfu and perform a blunt end ligation in say Eco RV cipped pBS vector or SnaBI/ Stu I cipped Litmus28. Clone it there and then cut with Bgl II.

Hope it helps



#4 HomeBrew



  • Global Moderators
  • PipPipPipPipPipPipPipPipPipPip
  • 930 posts

Posted 29 March 2009 - 04:32 AM

Alternatively, you could TA clone it, if you have the correct TA vector and used Taq, and digest that clone with BglII.

#5 leyhian83



  • Members
  • Pip
  • 3 posts

Posted 29 March 2009 - 05:15 AM

thank you all. I will redesign the primer.

Home - About - Terms of Service - Privacy - Contact Us

©1999-2013 Protocol Online, All rights reserved.